EMAIL THIS PAGE TO A FRIEND

RAD21

RAD21 homolog (S. pombe)

130 Gene Product Result for
Synonyms: CDLS4 HR21 HRAD21 MCD1 NXP1 SCC1 hHR21
UniProtKB ID: O60216, A8K0E0, Q15001, Q99568
Gene ID:
Human(5885) Summary: The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad21, a gene involved in the repair of DNA double-strand breaks, as well as in chromatid cohesion during mitosis. This protein is a nuclear phospho-protein, which becomes hyperphosphorylated in cell cycle M phase. The highly regulated association of this protein with mitotic chromatin specifically at the centromere region suggests its role in sister chromatid cohesion in mitotic cells. [provided by RefSeq, Jul 2008]
Mouse(19357) RAD21 homolog (S. pombe)
Rat(314949) RAD21 homolog (S. pombe)
chicken(420286) RAD21 homolog (S. pombe)
domestic cat(101095950) RAD21 homolog (S. pombe)
Horse(100065497) RAD21 homolog (S. pombe)
dog(482021) RAD21 homolog (S. pombe)
cow(540966) RAD21 homolog (S. pombe)
sheep(101115132) RAD21 homolog (S. pombe)
domestic guinea pig(100718361) RAD21 homolog (S. pombe)
naked mole-rat(101705536) RAD21 homolog (S. pombe)
Domestic Rabbit(100350479) RAD21 homolog (S. pombe)
Gene Class: Cell_Division
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006265 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009009 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009009 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009009 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006265 Rosetta Predictions human pricing
NM_001025701 Rosetta Predictions rat pricing
NM_009009 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195797 predicted 2079
2 SASI_Hs01_00195799 predicted 732
3 SASI_Hs02_00341218 predicted 1096
4 SASI_Hs02_00341219 predicted 1153
5 SASI_Hs01_00195800 predicted 1210
6 SASI_Hs01_00195801 predicted 814
7 SASI_Hs01_00195802 predicted 393
8 SASI_Hs01_00195803 predicted 491
9 SASI_Hs01_00195804 predicted 2001
10 SASI_Hs01_00195805 predicted 882
11 SASI_Hs01_00195796 predicted 1106
12 SASI_Hs01_00195798 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044117 predicted 817
2 SASI_Rn01_00044118 predicted 895
3 SASI_Rn01_00044119 predicted 1053
4 SASI_Rn01_00044120 predicted 901
5 SASI_Rn01_00044122 predicted 589
6 SASI_Rn01_00044123 predicted 868
7 SASI_Rn01_00044124 predicted 2166
8 SASI_Rn01_00044125 predicted 1080
9 SASI_Rn01_00044126 predicted 703
10 SASI_Rn02_00203321 predicted 620
11 SASI_Rn01_00044121 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054099 predicted 711
2 SASI_Mm01_00054100 predicted 1979
3 SASI_Mm01_00054102 predicted 1068
4 SASI_Mm02_00315150 predicted 967
5 SASI_Mm01_00054103 predicted 516
6 SASI_Mm01_00054104 predicted 1110
7 SASI_Mm02_00315151 predicted 266
8 SASI_Mm01_00054105 predicted 535
9 SASI_Mm01_00054106 predicted 1976
10 SASI_Mm01_00054107 predicted 748
11 SASI_Mm01_00054098 predicted 1019
12 SASI_Mm01_00054101 predicted 276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006265
VALIDATED
RAD21 MISSION shRNA Bacterial Glycerol Stock
RAD21 homolog (S. pombe)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006265.2-607s21c1
Sequence:CCGGGCCATTACTTTACCTGAAGAACTCGAGTTCTTCAGGTAAAGTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006265.2-1257s21c1
Sequence:CCGGGCTAATTGTTGACAGTGTCAACTCGAGTTGACACTGTCAACAATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006265.2-3273s21c1
Sequence:CCGGCCAGATAGCATCAGAAATCATCTCGAGATGATTTCTGATGCTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006265.2-2014s21c1
Sequence:CCGGGCTGAATCTATCAGTTTGCTTCTCGAGAAGCAAACTGATAGATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006265.1-3169s1c1
Sequence:CCGGCCAGATAGCATCAGAAATCATCTCGAGATGATTTCTGATGCTATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006265.1-1910s1c1
Sequence:CCGGGCTGAATCTATCAGTTTGCTTCTCGAGAAGCAAACTGATAGATTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006265.1-1153s1c1
Sequence:CCGGGCTAATTGTTGACAGTGTCAACTCGAGTTGACACTGTCAACAATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006265.1-503s1c1
Sequence:CCGGGCCATTACTTTACCTGAAGAACTCGAGTTCTTCAGGTAAAGTAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006265.1-1249s1c1
Sequence:CCGGGCCCACCAAGAAATTGATGATCTCGAGATCATCAATTTCTTGGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006265
VALIDATED
RAD21 MISSION shRNA shRNA Plasmid DNA
RAD21 homolog (S. pombe)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006265.2-607s21c1
Sequence:CCGGGCCATTACTTTACCTGAAGAACTCGAGTTCTTCAGGTAAAGTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006265.2-1257s21c1
Sequence:CCGGGCTAATTGTTGACAGTGTCAACTCGAGTTGACACTGTCAACAATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006265.2-3273s21c1
Sequence:CCGGCCAGATAGCATCAGAAATCATCTCGAGATGATTTCTGATGCTATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006265.2-2014s21c1
Sequence:CCGGGCTGAATCTATCAGTTTGCTTCTCGAGAAGCAAACTGATAGATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006265.1-3169s1c1
Sequence:CCGGCCAGATAGCATCAGAAATCATCTCGAGATGATTTCTGATGCTATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006265.1-1910s1c1
Sequence:CCGGGCTGAATCTATCAGTTTGCTTCTCGAGAAGCAAACTGATAGATTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006265.1-1153s1c1
Sequence:CCGGGCTAATTGTTGACAGTGTCAACTCGAGTTGACACTGTCAACAATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006265.1-503s1c1
Sequence:CCGGGCCATTACTTTACCTGAAGAACTCGAGTTCTTCAGGTAAAGTAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006265.1-1249s1c1
Sequence:CCGGGCCCACCAAGAAATTGATGATCTCGAGATCATCAATTTCTTGGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006265
VALIDATED
RAD21 MISSION shRNA Lentiviral Transduction Particles
RAD21 homolog (S. pombe)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006265.2-607s21c1
Sequence:CCGGGCCATTACTTTACCTGAAGAACTCGAGTTCTTCAGGTAAAGTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006265.2-1257s21c1
Sequence:CCGGGCTAATTGTTGACAGTGTCAACTCGAGTTGACACTGTCAACAATTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006265.2-3273s21c1
Sequence:CCGGCCAGATAGCATCAGAAATCATCTCGAGATGATTTCTGATGCTATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006265.2-2014s21c1
Sequence:CCGGGCTGAATCTATCAGTTTGCTTCTCGAGAAGCAAACTGATAGATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006265.1-3169s1c1
Sequence:CCGGCCAGATAGCATCAGAAATCATCTCGAGATGATTTCTGATGCTATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006265.1-1910s1c1
Sequence:CCGGGCTGAATCTATCAGTTTGCTTCTCGAGAAGCAAACTGATAGATTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006265.1-1153s1c1
Sequence:CCGGGCTAATTGTTGACAGTGTCAACTCGAGTTGACACTGTCAACAATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006265.1-503s1c1
Sequence:CCGGGCCATTACTTTACCTGAAGAACTCGAGTTCTTCAGGTAAAGTAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006265.1-1249s1c1
Sequence:CCGGGCCCACCAAGAAATTGATGATCTCGAGATCATCAATTTCTTGGTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009009
VALIDATED
RAD21 MISSION shRNA Bacterial Glycerol Stock
RAD21 homolog (S. pombe)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009009.3-1375s21c1
Sequence:CCGGTCATCGATGAGCCCATTATAGCTCGAGCTATAATGGGCTCATCGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009009.3-357s1c1
Sequence:CCGGGCTTATAATGCCATTACTTTACTCGAGTAAAGTAATGGCATTATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009009.3-714s1c1
Sequence:CCGGGGAAATGATGGCGGTATATTACTCGAGTAATATACCGCCATCATTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009009.3-961s1c1
Sequence:CCGGCGTTGGAGCCCATTGATATAACTCGAGTTATATCAATGGGCTCCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009009.3-959s21c1
Sequence:CCGGTGCGTTGGAGCCCATTGATATCTCGAGATATCAATGGGCTCCAACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009009.3-1067s21c1
Sequence:CCGGGCTTAGCGATTATTCTGATATCTCGAGATATCAGAATAATCGCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009009.3-2944s21c1
Sequence:CCGGGCACCAGAAATTATGTGACTACTCGAGTAGTCACATAATTTCTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009009.3-1287s21c1
Sequence:CCGGGATGAGTTCCTCAAAGAGTTTCTCGAGAAACTCTTTGAGGAACTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009009.2-2235s1c1
Sequence:CCGGGCATGTAAGAATATGGAGTAACTCGAGTTACTCCATATTCTTACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009009.2-1068s1c1
Sequence:CCGGGCTTAGCGATTATTCTGATATCTCGAGATATCAGAATAATCGCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009009.2-2945s1c1
Sequence:CCGGGCACCAGAAATTATGTGACTACTCGAGTAGTCACATAATTTCTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009009.2-138s1c1
Sequence:CCGGCCATGTATTTGAGTGCAACTTCTCGAGAAGTTGCACTCAAATACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009009.2-1288s1c1
Sequence:CCGGGATGAGTTCCTCAAAGAGTTTCTCGAGAAACTCTTTGAGGAACTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009009
VALIDATED
RAD21 MISSION shRNA shRNA Plasmid DNA
RAD21 homolog (S. pombe)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009009.3-1375s21c1
Sequence:CCGGTCATCGATGAGCCCATTATAGCTCGAGCTATAATGGGCTCATCGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009009.3-357s1c1
Sequence:CCGGGCTTATAATGCCATTACTTTACTCGAGTAAAGTAATGGCATTATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009009.3-714s1c1
Sequence:CCGGGGAAATGATGGCGGTATATTACTCGAGTAATATACCGCCATCATTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009009.3-961s1c1
Sequence:CCGGCGTTGGAGCCCATTGATATAACTCGAGTTATATCAATGGGCTCCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009009.3-959s21c1
Sequence:CCGGTGCGTTGGAGCCCATTGATATCTCGAGATATCAATGGGCTCCAACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009009.3-1067s21c1
Sequence:CCGGGCTTAGCGATTATTCTGATATCTCGAGATATCAGAATAATCGCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009009.3-2944s21c1
Sequence:CCGGGCACCAGAAATTATGTGACTACTCGAGTAGTCACATAATTTCTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009009.3-1287s21c1
Sequence:CCGGGATGAGTTCCTCAAAGAGTTTCTCGAGAAACTCTTTGAGGAACTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009009.2-2235s1c1
Sequence:CCGGGCATGTAAGAATATGGAGTAACTCGAGTTACTCCATATTCTTACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009009.2-1068s1c1
Sequence:CCGGGCTTAGCGATTATTCTGATATCTCGAGATATCAGAATAATCGCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009009.2-2945s1c1
Sequence:CCGGGCACCAGAAATTATGTGACTACTCGAGTAGTCACATAATTTCTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009009.2-138s1c1
Sequence:CCGGCCATGTATTTGAGTGCAACTTCTCGAGAAGTTGCACTCAAATACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009009.2-1288s1c1
Sequence:CCGGGATGAGTTCCTCAAAGAGTTTCTCGAGAAACTCTTTGAGGAACTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009009
VALIDATED
RAD21 MISSION shRNA Lentiviral Transduction Particles
RAD21 homolog (S. pombe)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009009.3-1375s21c1
Sequence:CCGGTCATCGATGAGCCCATTATAGCTCGAGCTATAATGGGCTCATCGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009009.3-357s1c1
Sequence:CCGGGCTTATAATGCCATTACTTTACTCGAGTAAAGTAATGGCATTATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009009.3-714s1c1
Sequence:CCGGGGAAATGATGGCGGTATATTACTCGAGTAATATACCGCCATCATTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009009.3-961s1c1
Sequence:CCGGCGTTGGAGCCCATTGATATAACTCGAGTTATATCAATGGGCTCCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009009.3-959s21c1
Sequence:CCGGTGCGTTGGAGCCCATTGATATCTCGAGATATCAATGGGCTCCAACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009009.3-1067s21c1
Sequence:CCGGGCTTAGCGATTATTCTGATATCTCGAGATATCAGAATAATCGCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009009.3-2944s21c1
Sequence:CCGGGCACCAGAAATTATGTGACTACTCGAGTAGTCACATAATTTCTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009009.3-1287s21c1
Sequence:CCGGGATGAGTTCCTCAAAGAGTTTCTCGAGAAACTCTTTGAGGAACTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009009.2-2235s1c1
Sequence:CCGGGCATGTAAGAATATGGAGTAACTCGAGTTACTCCATATTCTTACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009009.2-1068s1c1
Sequence:CCGGGCTTAGCGATTATTCTGATATCTCGAGATATCAGAATAATCGCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009009.2-2945s1c1
Sequence:CCGGGCACCAGAAATTATGTGACTACTCGAGTAGTCACATAATTTCTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009009.2-138s1c1
Sequence:CCGGCCATGTATTTGAGTGCAACTTCTCGAGAAGTTGCACTCAAATACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009009.2-1288s1c1
Sequence:CCGGGATGAGTTCCTCAAAGAGTTTCTCGAGAAACTCTTTGAGGAACTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)