EMAIL THIS PAGE TO A FRIEND

RAD21L1

RAD21-like 1 (S. pombe)

36 Gene Product Result for
Synonyms: RAD21L dJ545L17.2
UniProtKB ID: Q9H4I0, B2RXL0, B7ZBB1, B7ZW76, Q5W0X5
Gene ID:
Rat(689823) RAD21-like 1 (S. pombe)
cow(512408) RAD21-like 1 (S. pombe)
sheep(101120683) RAD21-like 1 (S. pombe)
Domestic Rabbit(100339468) RAD21-like 1 (S. pombe)
naked mole-rat(101719447) RAD21-like 1 (S. pombe)
domestic guinea pig(100716199) RAD21-like 1 (S. pombe)
Zebrafish(571082) RAD21-like 1 (S. pombe)
domestic cat(101100879) RAD21-like 1 (S. pombe)
dog(609572) RAD21-like 1 (S. pombe)
chicken(419269) RAD21-like 1 (S. pombe)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136566 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU221831 MISSION® esiRNA esiRNA targeting human RAD21L1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717761 Rosetta Predictions human pricing
XM_926105 Rosetta Predictions human pricing
XM_001072159 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00419294 predicted 706
2 SASI_Hs02_00419295 predicted 494
3 SASI_Hs02_00419296 predicted 1110
4 SASI_Hs02_00419297 predicted 666
5 SASI_Hs02_00419298 predicted 669
6 SASI_Hs02_00419299 predicted 580
7 SASI_Hs02_00419300 predicted 806
8 SASI_Hs02_00419301 predicted 1251
9 SASI_Hs02_00419302 predicted 1049
10 SASI_Hs02_00419303 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278370 predicted 583
2 SASI_Hs01_00278371 predicted 739
3 SASI_Hs01_00278372 predicted 736
4 SASI_Hs01_00278373 predicted 568
5 SASI_Hs01_00278374 predicted 635
6 SASI_Hs01_00278375 predicted 801
7 SASI_Hs01_00278376 predicted 664
8 SASI_Hs01_00278377 predicted 587
9 SASI_Hs01_00278378 predicted 802
10 SASI_Hs01_00278379 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072159 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338048 predicted 230
2 SASI_Rn02_00338049 predicted 232
3 SASI_Rn02_00338050 predicted 318
4 SASI_Rn02_00338051 predicted 251
5 SASI_Rn02_00338052 predicted 223
6 SASI_Rn02_00338053 predicted 296
7 SASI_Rn02_00338054 predicted 313
8 SASI_Rn02_00338055 predicted 299
9 SASI_Rn02_00338056 predicted 317
10 SASI_Rn02_00338057 predicted 257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136566
RAD21L1 MISSION shRNA Bacterial Glycerol Stock
RAD21-like 1 (S. pombe)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136566.2-1284s21c1
Sequence:CCGGCATGATGCAAGAGCCAAATTACTCGAGTAATTTGGCTCTTGCATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136566.2-276s21c1
Sequence:CCGGGGGAGTTGTTCGAATCTATAACTCGAGTTATAGATTCGAACAACTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136566.2-730s21c1
Sequence:CCGGGAAATGATTGACAATCTATTGCTCGAGCAATAGATTGTCAATCATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136566.2-924s21c1
Sequence:CCGGTACCCTTGATCCAATTGATATCTCGAGATATCAATTGGATCAAGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136566.2-1366s21c1
Sequence:CCGGTCTCATGAGGATACCAATAAACTCGAGTTTATTGGTATCCTCATGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136566
RAD21L1 MISSION shRNA shRNA Plasmid DNA
RAD21-like 1 (S. pombe)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136566.2-1284s21c1
Sequence:CCGGCATGATGCAAGAGCCAAATTACTCGAGTAATTTGGCTCTTGCATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136566.2-276s21c1
Sequence:CCGGGGGAGTTGTTCGAATCTATAACTCGAGTTATAGATTCGAACAACTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136566.2-730s21c1
Sequence:CCGGGAAATGATTGACAATCTATTGCTCGAGCAATAGATTGTCAATCATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136566.2-924s21c1
Sequence:CCGGTACCCTTGATCCAATTGATATCTCGAGATATCAATTGGATCAAGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136566.2-1366s21c1
Sequence:CCGGTCTCATGAGGATACCAATAAACTCGAGTTTATTGGTATCCTCATGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136566
RAD21L1 MISSION shRNA Lentiviral Transduction Particles
RAD21-like 1 (S. pombe)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136566.2-1284s21c1
Sequence:CCGGCATGATGCAAGAGCCAAATTACTCGAGTAATTTGGCTCTTGCATCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136566.2-276s21c1
Sequence:CCGGGGGAGTTGTTCGAATCTATAACTCGAGTTATAGATTCGAACAACTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136566.2-730s21c1
Sequence:CCGGGAAATGATTGACAATCTATTGCTCGAGCAATAGATTGTCAATCATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136566.2-924s21c1
Sequence:CCGGTACCCTTGATCCAATTGATATCTCGAGATATCAATTGGATCAAGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136566.2-1366s21c1
Sequence:CCGGTCTCATGAGGATACCAATAAACTCGAGTTTATTGGTATCCTCATGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)