EMAIL THIS PAGE TO A FRIEND

RAD50

RAD50 homolog (S. cerevisiae)

76 Gene Product Result for
Synonyms: NBSLD RAD502 hRad50
UniProtKB ID: Q92878, B9EGF5, O43254, Q6GMT7, Q6P5X3, Q9UP86
Gene ID:
Human(10111) Summary: The protein encoded by this gene is highly similar to Saccharomyces cerevisiae Rad50, a protein involved in DNA double-strand break repair. This protein forms a complex with MRE11 and NBS1. The protein complex binds to DNA and displays numerous enzymatic activities that are required for nonhomologous joining of DNA ends. This protein, cooperating with its partners, is important for DNA double-strand break repair, cell cycle checkpoint activation, telomere maintenance, and meiotic recombination. Knockout studies of the mouse homolog suggest this gene is essential for cell growth and viability. Mutations in this gene are the cause of Nijmegen breakage syndrome-like disorder.[provided by RefSeq, Apr 2010]
Mouse(19360) RAD50 homolog (S. cerevisiae)
Rat(64012) RAD50 homolog (S. cerevisiae)
fruit fly(37564) CG6339 gene product from transcript CG6339-RE
Thale Cress(817756) DNA repair protein RAD50
Horse(100063198) RAD50 homolog (S. cerevisiae)
domestic cat(101095875) RAD50 homolog (S. cerevisiae)
dog(474674) RAD50 homolog (S. cerevisiae)
chicken(416329) RAD50 homolog (S. cerevisiae)
Zebrafish(553029) RAD50 homolog (S. cerevisiae)
domestic guinea pig(100719847) RAD50 homolog (S. cerevisiae)
naked mole-rat(101719180) RAD50 homolog (S. cerevisiae)
Domestic Rabbit(100328725) RAD50 homolog (S. cerevisiae)
cow(788127) RAD50 homolog (S. cerevisiae)
sheep(101123035) RAD50 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2701425 Anti-RAD50 (N-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
R1653 Anti-RAD50 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension rodent, human
immunohistochemistry, western blot pricing
HPA052291 Anti-RAD50 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2701426 Anti-RAD50 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB4500036 Anti-RAD50 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB2702155 Monoclonal Anti-RAD50 antibody produced in mouse rat, mouse, monkey, human
immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
PLA0058 Rabbit anti-Rad50 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009012 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009012 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009012 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005732 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005732 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005732 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005732 Rosetta Predictions human pricing
NM_133482 Rosetta Predictions human pricing
NM_022246 Rosetta Predictions rat pricing
NM_009012 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182043 predicted 2299
2 SASI_Hs01_00182045 predicted 2886
3 SASI_Hs02_00340164 predicted 1529
4 SASI_Hs01_00182046 predicted 1956
5 SASI_Hs01_00182047 predicted 2843
6 SASI_Hs01_00182048 predicted 2826
7 SASI_Hs02_00340165 predicted 407
8 SASI_Hs01_00182049 predicted 4106
9 SASI_Hs01_00182051 predicted 3848
10 SASI_Hs02_00340166 predicted 2916
11 SASI_Hs01_00182042 predicted 1674
12 SASI_Hs01_00182044 predicted 3755
13 SASI_Hs01_00182050 predicted 3852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093890 predicted 2236
2 SASI_Hs01_00093892 predicted 2829
3 SASI_Hs02_00363201 predicted 1463
4 SASI_Hs01_00093893 predicted 1898
5 SASI_Hs01_00093894 predicted 2776
6 SASI_Hs01_00093895 predicted 2765
7 SASI_Hs02_00363202 predicted 982
8 SASI_Hs01_00093896 predicted 4039
9 SASI_Hs01_00093898 predicted 3782
10 SASI_Hs02_00363203 predicted 2858
11 SASI_Hs01_00093889 predicted 1613
12 SASI_Hs01_00093891 predicted 3682
13 SASI_Hs01_00093897 predicted 3789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117767 predicted 1725
2 SASI_Rn01_00117768 predicted 632
3 SASI_Rn02_00263022 predicted 765
4 SASI_Rn01_00117769 predicted 817
5 SASI_Rn01_00117770 predicted 3612
6 SASI_Rn01_00117771 predicted 2663
7 SASI_Rn01_00117772 predicted 2684
8 SASI_Rn01_00117774 predicted 4122
9 SASI_Rn02_00263023 predicted 3187
10 SASI_Rn01_00117776 predicted 3847
11 SASI_Rn01_00117773 predicted 287
12 SASI_Rn01_00117775 predicted 3158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117825 predicted 2162
2 SASI_Mm01_00117826 predicted 3495
3 SASI_Mm01_00117827 predicted 4050
4 SASI_Mm01_00117828 predicted 3721
5 SASI_Mm01_00117830 predicted 811
6 SASI_Mm01_00117831 predicted 2123
7 SASI_Mm01_00117832 predicted 3918
8 SASI_Mm02_00315160 predicted 1932
9 SASI_Mm02_00315161 predicted 930
10 SASI_Mm02_00315162 predicted 3977
11 SASI_Mm01_00117824 predicted 1823
12 SASI_Mm01_00117829 predicted 2777
13 SASI_Mm01_00117833 predicted 2102
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009012
VALIDATED
RAD50 MISSION shRNA Bacterial Glycerol Stock
RAD50 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009012.2-1709s21c1
Sequence:CCGGCGAAAGCTGAACGTGAATTAACTCGAGTTAATTCACGTTCAGCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009012.2-2168s21c1
Sequence:CCGGGCCAAGATTTGGAAAGTGATTCTCGAGAATCACTTTCCAAATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009012.2-4423s21c1
Sequence:CCGGTCTGAAGCTTGAAGGTATATTCTCGAGAATATACCTTCAAGCTTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009012.2-1012s21c1
Sequence:CCGGCCATTGAAGAATCGCCTGAAACTCGAGTTTCAGGCGATTCTTCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009012.1-2146s1c1
Sequence:CCGGGCCAAGATTTGGAAAGTGATTCTCGAGAATCACTTTCCAAATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009012.1-990s1c1
Sequence:CCGGCCATTGAAGAATCGCCTGAAACTCGAGTTTCAGGCGATTCTTCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009012.1-1687s1c1
Sequence:CCGGCGAAAGCTGAACGTGAATTAACTCGAGTTAATTCACGTTCAGCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009012.1-4021s1c1
Sequence:CCGGGCAACTTCCAACTTCTGGTAACTCGAGTTACCAGAAGTTGGAAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009012.1-4594s1c1
Sequence:CCGGGCTGGCTGTTAGAGAAGAGTTCTCGAGAACTCTTCTCTAACAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009012
VALIDATED
RAD50 MISSION shRNA shRNA Plasmid DNA
RAD50 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009012.2-1709s21c1
Sequence:CCGGCGAAAGCTGAACGTGAATTAACTCGAGTTAATTCACGTTCAGCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009012.2-2168s21c1
Sequence:CCGGGCCAAGATTTGGAAAGTGATTCTCGAGAATCACTTTCCAAATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009012.2-4423s21c1
Sequence:CCGGTCTGAAGCTTGAAGGTATATTCTCGAGAATATACCTTCAAGCTTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009012.2-1012s21c1
Sequence:CCGGCCATTGAAGAATCGCCTGAAACTCGAGTTTCAGGCGATTCTTCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009012.1-2146s1c1
Sequence:CCGGGCCAAGATTTGGAAAGTGATTCTCGAGAATCACTTTCCAAATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009012.1-990s1c1
Sequence:CCGGCCATTGAAGAATCGCCTGAAACTCGAGTTTCAGGCGATTCTTCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009012.1-1687s1c1
Sequence:CCGGCGAAAGCTGAACGTGAATTAACTCGAGTTAATTCACGTTCAGCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009012.1-4021s1c1
Sequence:CCGGGCAACTTCCAACTTCTGGTAACTCGAGTTACCAGAAGTTGGAAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009012.1-4594s1c1
Sequence:CCGGGCTGGCTGTTAGAGAAGAGTTCTCGAGAACTCTTCTCTAACAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009012
VALIDATED
RAD50 MISSION shRNA Lentiviral Transduction Particles
RAD50 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009012.2-1709s21c1
Sequence:CCGGCGAAAGCTGAACGTGAATTAACTCGAGTTAATTCACGTTCAGCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009012.2-2168s21c1
Sequence:CCGGGCCAAGATTTGGAAAGTGATTCTCGAGAATCACTTTCCAAATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009012.2-4423s21c1
Sequence:CCGGTCTGAAGCTTGAAGGTATATTCTCGAGAATATACCTTCAAGCTTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009012.2-1012s21c1
Sequence:CCGGCCATTGAAGAATCGCCTGAAACTCGAGTTTCAGGCGATTCTTCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009012.1-2146s1c1
Sequence:CCGGGCCAAGATTTGGAAAGTGATTCTCGAGAATCACTTTCCAAATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009012.1-990s1c1
Sequence:CCGGCCATTGAAGAATCGCCTGAAACTCGAGTTTCAGGCGATTCTTCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009012.1-1687s1c1
Sequence:CCGGCGAAAGCTGAACGTGAATTAACTCGAGTTAATTCACGTTCAGCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009012.1-4021s1c1
Sequence:CCGGGCAACTTCCAACTTCTGGTAACTCGAGTTACCAGAAGTTGGAAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009012.1-4594s1c1
Sequence:CCGGGCTGGCTGTTAGAGAAGAGTTCTCGAGAACTCTTCTCTAACAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005732
VALIDATED
RAD50 MISSION shRNA Bacterial Glycerol Stock
RAD50 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005732.2-4394s21c1
Sequence:CCGGCTCATATCAACTTAGTCAATACTCGAGTATTGACTAAGTTGATATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005732.2-1477s21c1
Sequence:CCGGATCCGAGCTAGAGATTCATTACTCGAGTAATGAATCTCTAGCTCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005732.2-1134s21c1
Sequence:CCGGTCCATTGAAGAATCGTCTAAACTCGAGTTTAGACGATTCTTCAATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005732.2-3738s21c1
Sequence:CCGGGAACAAGGATCTGGATATTTACTCGAGTAAATATCCAGATCCTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005732.x-5531s1c1
Sequence:CCGGCATCTATCTGTGCTAGGTTAACTCGAGTTAACCTAGCACAGATAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005732.x-1051s1c1
Sequence:CCGGAGATTCGTGATCAGATTACACTCGAGTGTAATCTGATCACGAATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005732.2-515s1c1
Sequence:CCGGCGACCATCATTGAATGTCTAACTCGAGTTAGACATTCAATGATGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005732.2-2674s21c1
Sequence:CCGGCGCCTAAAGAACGACATAGAACTCGAGTTCTATGTCGTTCTTTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005732.2-5411s1c1
Sequence:CCGGCGGGTCTTGATTCAGTCACATCTCGAGATGTGACTGAATCAAGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005732.2-2170s1c1
Sequence:CCGGGCCAAATTGAACAAGGAACTACTCGAGTAGTTCCTTGTTCAATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005732.2-832s1c1
Sequence:CCGGGCTGTGCTAAATAATGTCATTCTCGAGAATGACATTATTTAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005732.2-2674s1c1
Sequence:CCGGCGCCTAAAGAACGACATAGAACTCGAGTTCTATGTCGTTCTTTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005732
VALIDATED
RAD50 MISSION shRNA shRNA Plasmid DNA
RAD50 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005732.2-4394s21c1
Sequence:CCGGCTCATATCAACTTAGTCAATACTCGAGTATTGACTAAGTTGATATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005732.2-1477s21c1
Sequence:CCGGATCCGAGCTAGAGATTCATTACTCGAGTAATGAATCTCTAGCTCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005732.2-1134s21c1
Sequence:CCGGTCCATTGAAGAATCGTCTAAACTCGAGTTTAGACGATTCTTCAATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005732.2-3738s21c1
Sequence:CCGGGAACAAGGATCTGGATATTTACTCGAGTAAATATCCAGATCCTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005732.x-5531s1c1
Sequence:CCGGCATCTATCTGTGCTAGGTTAACTCGAGTTAACCTAGCACAGATAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005732.x-1051s1c1
Sequence:CCGGAGATTCGTGATCAGATTACACTCGAGTGTAATCTGATCACGAATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005732.2-515s1c1
Sequence:CCGGCGACCATCATTGAATGTCTAACTCGAGTTAGACATTCAATGATGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005732.2-2674s21c1
Sequence:CCGGCGCCTAAAGAACGACATAGAACTCGAGTTCTATGTCGTTCTTTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005732.2-5411s1c1
Sequence:CCGGCGGGTCTTGATTCAGTCACATCTCGAGATGTGACTGAATCAAGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005732.2-2170s1c1
Sequence:CCGGGCCAAATTGAACAAGGAACTACTCGAGTAGTTCCTTGTTCAATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005732.2-832s1c1
Sequence:CCGGGCTGTGCTAAATAATGTCATTCTCGAGAATGACATTATTTAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005732.2-2674s1c1
Sequence:CCGGCGCCTAAAGAACGACATAGAACTCGAGTTCTATGTCGTTCTTTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005732
VALIDATED
RAD50 MISSION shRNA Lentiviral Transduction Particles
RAD50 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005732.2-4394s21c1
Sequence:CCGGCTCATATCAACTTAGTCAATACTCGAGTATTGACTAAGTTGATATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005732.2-1477s21c1
Sequence:CCGGATCCGAGCTAGAGATTCATTACTCGAGTAATGAATCTCTAGCTCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005732.2-1134s21c1
Sequence:CCGGTCCATTGAAGAATCGTCTAAACTCGAGTTTAGACGATTCTTCAATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005732.2-3738s21c1
Sequence:CCGGGAACAAGGATCTGGATATTTACTCGAGTAAATATCCAGATCCTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005732.x-5531s1c1
Sequence:CCGGCATCTATCTGTGCTAGGTTAACTCGAGTTAACCTAGCACAGATAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005732.x-1051s1c1
Sequence:CCGGAGATTCGTGATCAGATTACACTCGAGTGTAATCTGATCACGAATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005732.2-515s1c1
Sequence:CCGGCGACCATCATTGAATGTCTAACTCGAGTTAGACATTCAATGATGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005732.2-2674s21c1
Sequence:CCGGCGCCTAAAGAACGACATAGAACTCGAGTTCTATGTCGTTCTTTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005732.2-5411s1c1
Sequence:CCGGCGGGTCTTGATTCAGTCACATCTCGAGATGTGACTGAATCAAGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005732.2-2170s1c1
Sequence:CCGGGCCAAATTGAACAAGGAACTACTCGAGTAGTTCCTTGTTCAATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005732.2-832s1c1
Sequence:CCGGGCTGTGCTAAATAATGTCATTCTCGAGAATGACATTATTTAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005732.2-2674s1c1
Sequence:CCGGCGCCTAAAGAACGACATAGAACTCGAGTTCTATGTCGTTCTTTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)