EMAIL THIS PAGE TO A FRIEND

RAD51

RAD51 recombinase

98 Gene Product Result for
Synonyms: BRCC5 HRAD51 HsRad51 HsT16930 MRMV2 RAD51A RECA
UniProtKB ID: Q06609, B0FXP0, B2R8T6, Q6FHX9, Q6ZNA8, Q9BV60
Gene ID:
Human(5888) Summary: The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51, and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with the ssDNA-binding protein RPA and RAD52, and it is thought to play roles in homologous pairing and strand transfer of DNA. This protein is also found to interact with BRCA1 and BRCA2, which may be important for the cellular response to DNA damage. BRCA2 is shown to regulate both the intracellular localization and DNA-binding ability of this protein. Loss of these controls following BRCA2 inactivation may be a key event leading to genomic instability and tumorigenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Mouse(19361) RAD51 homolog
Rat(499870) RAD51 recombinase
cow(514749) RAD51 homolog (S. cerevisiae)
sheep(101109275) RAD51 homolog (S. cerevisiae)
Domestic Rabbit(100008661) RAD51 homolog (S. cerevisiae)
naked mole-rat(101715048) RAD51 homolog (S. cerevisiae)
domestic guinea pig(100716391) RAD51 homolog (S. cerevisiae)
Thale Cress(832208) DNA repair protein RAD51-like 1
chicken(396086) RAD51 homolog (S. cerevisiae)
dog(403568) RAD51 homolog (S. cerevisiae)
domestic cat(101089015) RAD51 homolog (S. cerevisiae)
Zebrafish(406487) RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002875 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002875 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002875 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011234 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011234 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011234 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045521 MISSION® esiRNA esiRNA human RAD51 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002875 Rosetta Predictions human pricing
NM_133487 Rosetta Predictions human pricing
NM_001109204 Rosetta Predictions rat pricing
NM_011234 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018925 predicted 1056
2 SASI_Hs01_00018926 predicted 1585
3 SASI_Hs01_00018927 predicted 1114
4 SASI_Hs01_00018928 predicted 1453
5 SASI_Hs01_00018929 predicted 1231
6 SASI_Hs01_00018930 predicted 1678
7 SASI_Hs02_00334650 predicted 1494
8 SASI_Hs01_00018931 predicted 1386
9 SASI_Hs01_00018932 predicted 1645
10 SASI_Hs01_00018933 predicted 1570
11 SASI_Hs01_00018934 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096904 predicted 767
2 SASI_Hs01_00096905 predicted 1291
3 SASI_Hs01_00096906 predicted 827
4 SASI_Hs01_00096907 predicted 1158
5 SASI_Hs01_00096908 predicted 944
6 SASI_Hs01_00096909 predicted 1384
7 SASI_Hs02_00363207 predicted 1206
8 SASI_Hs01_00096910 predicted 1096
9 SASI_Hs01_00096911 predicted 1358
10 SASI_Hs01_00096912 predicted 1286
11 SASI_Hs01_00096913 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109204 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246120 predicted 450
2 SASI_Rn02_00246121 predicted 1078
3 SASI_Rn02_00246122 predicted 344
4 SASI_Rn02_00246123 predicted 759
5 SASI_Rn02_00246124 predicted 1047
6 SASI_Rn02_00246125 predicted 514
7 SASI_Rn02_00246126 predicted 378
8 SASI_Rn02_00246127 predicted 858
9 SASI_Rn02_00246128 predicted 588
10 SASI_Rn02_00246129 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011234 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165230 predicted 519
2 SASI_Mm01_00165232 predicted 1084
3 SASI_Mm01_00165233 predicted 768
4 SASI_Mm01_00165234 predicted 920
5 SASI_Mm01_00165235 predicted 859
6 SASI_Mm01_00165236 predicted 587
7 SASI_Mm02_00320201 predicted 286
8 SASI_Mm01_00165237 predicted 894
9 SASI_Mm01_00165238 predicted 502
10 SASI_Mm01_00165239 predicted 559
11 SASI_Mm01_00165231 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002875
VALIDATED
RAD51 MISSION shRNA Bacterial Glycerol Stock
RAD51 recombinase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002875.2-1853s1c1
Sequence:CCGGGCTAAGACTAACTCAAGATAACTCGAGTTATCTTGAGTTAGTCTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002875.2-543s1c1
Sequence:CCGGCGGTCAGAGATCATACAGATTCTCGAGAATCTGTATGATCTCTGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002875.2-932s1c1
Sequence:CCGGCGCCCTTTACAGAACAGACTACTCGAGTAGTCTGTTCTGTAAAGGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002875.2-1224s1c1
Sequence:CCGGGCTGAAGCTATGTTCGCCATTCTCGAGAATGGCGAACATAGCTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.49 Cell Line: A549
TRC Version: 1 Clone ID:NM_002875.2-321s1c1
Sequence:CCGGCCACAACCCATTTCACGGTTACTCGAGTAACCGTGAAATGGGTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002875.3-1234s21c1
Sequence:CCGGGCTGAAGCTATGTTCGCCATTCTCGAGAATGGCGAACATAGCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002875.3-349s21c1
Sequence:CCGGTTAGAGCAGTGTGGCATAAATCTCGAGATTTATGCCACACTGCTCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002875.3-942s21c1
Sequence:CCGGCGCCCTTTACAGAACAGACTACTCGAGTAGTCTGTTCTGTAAAGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002875.3-553s21c1
Sequence:CCGGCGGTCAGAGATCATACAGATTCTCGAGAATCTGTATGATCTCTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002875
VALIDATED
RAD51 MISSION shRNA shRNA Plasmid DNA
RAD51 recombinase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002875.2-1853s1c1
Sequence:CCGGGCTAAGACTAACTCAAGATAACTCGAGTTATCTTGAGTTAGTCTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002875.2-543s1c1
Sequence:CCGGCGGTCAGAGATCATACAGATTCTCGAGAATCTGTATGATCTCTGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002875.2-932s1c1
Sequence:CCGGCGCCCTTTACAGAACAGACTACTCGAGTAGTCTGTTCTGTAAAGGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002875.2-1224s1c1
Sequence:CCGGGCTGAAGCTATGTTCGCCATTCTCGAGAATGGCGAACATAGCTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.49 Cell Line: A549
TRC Version: 1 Clone ID:NM_002875.2-321s1c1
Sequence:CCGGCCACAACCCATTTCACGGTTACTCGAGTAACCGTGAAATGGGTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002875.3-1234s21c1
Sequence:CCGGGCTGAAGCTATGTTCGCCATTCTCGAGAATGGCGAACATAGCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002875.3-349s21c1
Sequence:CCGGTTAGAGCAGTGTGGCATAAATCTCGAGATTTATGCCACACTGCTCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002875.3-942s21c1
Sequence:CCGGCGCCCTTTACAGAACAGACTACTCGAGTAGTCTGTTCTGTAAAGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002875.3-553s21c1
Sequence:CCGGCGGTCAGAGATCATACAGATTCTCGAGAATCTGTATGATCTCTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002875
VALIDATED
RAD51 MISSION shRNA Lentiviral Transduction Particles
RAD51 recombinase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002875.2-1853s1c1
Sequence:CCGGGCTAAGACTAACTCAAGATAACTCGAGTTATCTTGAGTTAGTCTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002875.2-543s1c1
Sequence:CCGGCGGTCAGAGATCATACAGATTCTCGAGAATCTGTATGATCTCTGACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002875.2-932s1c1
Sequence:CCGGCGCCCTTTACAGAACAGACTACTCGAGTAGTCTGTTCTGTAAAGGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002875.2-1224s1c1
Sequence:CCGGGCTGAAGCTATGTTCGCCATTCTCGAGAATGGCGAACATAGCTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.49 Cell Line: A549
TRC Version: 1 Clone ID:NM_002875.2-321s1c1
Sequence:CCGGCCACAACCCATTTCACGGTTACTCGAGTAACCGTGAAATGGGTTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002875.3-1234s21c1
Sequence:CCGGGCTGAAGCTATGTTCGCCATTCTCGAGAATGGCGAACATAGCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002875.3-349s21c1
Sequence:CCGGTTAGAGCAGTGTGGCATAAATCTCGAGATTTATGCCACACTGCTCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002875.3-942s21c1
Sequence:CCGGCGCCCTTTACAGAACAGACTACTCGAGTAGTCTGTTCTGTAAAGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002875.3-553s21c1
Sequence:CCGGCGGTCAGAGATCATACAGATTCTCGAGAATCTGTATGATCTCTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011234
RAD51 MISSION shRNA Bacterial Glycerol Stock
RAD51 recombinase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011234.2-285s1c1
Sequence:CCGGCCACAGCCTATTTCACGGTTACTCGAGTAACCGTGAAATAGGCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011234.2-1188s1c1
Sequence:CCGGGCTGAAGCTATGTTTGCCATTCTCGAGAATGGCAAACATAGCTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011234.2-507s1c1
Sequence:CCGGCGGTCAGAGATCATACAGATACTCGAGTATCTGTATGATCTCTGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011234.2-324s1c1
Sequence:CCGGGCCAATGATGTGAAGAAATTACTCGAGTAATTTCTTCACATCATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011234.2-1259s1c1
Sequence:CCGGCCTGTGATGCTATACGGCTTTCTCGAGAAAGCCGTATAGCATCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011234.4-1258s21c1
Sequence:CCGGCCTGTGATGCTATACGGCTTTCTCGAGAAAGCCGTATAGCATCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011234.4-284s21c1
Sequence:CCGGCCACAGCCTATTTCACGGTTACTCGAGTAACCGTGAAATAGGCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011234.4-1187s21c1
Sequence:CCGGGCTGAAGCTATGTTTGCCATTCTCGAGAATGGCAAACATAGCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011234.4-506s21c1
Sequence:CCGGCGGTCAGAGATCATACAGATACTCGAGTATCTGTATGATCTCTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011234
RAD51 MISSION shRNA shRNA Plasmid DNA
RAD51 recombinase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011234.2-285s1c1
Sequence:CCGGCCACAGCCTATTTCACGGTTACTCGAGTAACCGTGAAATAGGCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011234.2-1188s1c1
Sequence:CCGGGCTGAAGCTATGTTTGCCATTCTCGAGAATGGCAAACATAGCTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011234.2-507s1c1
Sequence:CCGGCGGTCAGAGATCATACAGATACTCGAGTATCTGTATGATCTCTGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011234.2-324s1c1
Sequence:CCGGGCCAATGATGTGAAGAAATTACTCGAGTAATTTCTTCACATCATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011234.2-1259s1c1
Sequence:CCGGCCTGTGATGCTATACGGCTTTCTCGAGAAAGCCGTATAGCATCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011234.4-1258s21c1
Sequence:CCGGCCTGTGATGCTATACGGCTTTCTCGAGAAAGCCGTATAGCATCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011234.4-284s21c1
Sequence:CCGGCCACAGCCTATTTCACGGTTACTCGAGTAACCGTGAAATAGGCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011234.4-1187s21c1
Sequence:CCGGGCTGAAGCTATGTTTGCCATTCTCGAGAATGGCAAACATAGCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011234.4-506s21c1
Sequence:CCGGCGGTCAGAGATCATACAGATACTCGAGTATCTGTATGATCTCTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011234
RAD51 MISSION shRNA Lentiviral Transduction Particles
RAD51 recombinase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011234.2-285s1c1
Sequence:CCGGCCACAGCCTATTTCACGGTTACTCGAGTAACCGTGAAATAGGCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011234.2-1188s1c1
Sequence:CCGGGCTGAAGCTATGTTTGCCATTCTCGAGAATGGCAAACATAGCTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011234.2-507s1c1
Sequence:CCGGCGGTCAGAGATCATACAGATACTCGAGTATCTGTATGATCTCTGACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011234.2-324s1c1
Sequence:CCGGGCCAATGATGTGAAGAAATTACTCGAGTAATTTCTTCACATCATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011234.2-1259s1c1
Sequence:CCGGCCTGTGATGCTATACGGCTTTCTCGAGAAAGCCGTATAGCATCACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011234.4-1258s21c1
Sequence:CCGGCCTGTGATGCTATACGGCTTTCTCGAGAAAGCCGTATAGCATCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011234.4-284s21c1
Sequence:CCGGCCACAGCCTATTTCACGGTTACTCGAGTAACCGTGAAATAGGCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011234.4-1187s21c1
Sequence:CCGGGCTGAAGCTATGTTTGCCATTCTCGAGAATGGCAAACATAGCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011234.4-506s21c1
Sequence:CCGGCGGTCAGAGATCATACAGATACTCGAGTATCTGTATGATCTCTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)