EMAIL THIS PAGE TO A FRIEND

RAD51AP1

RAD51 associated protein 1

87 Gene Product Result for
Synonyms: PIR51
UniProtKB ID: Q96B01, A8K7D3, O43403, Q7Z779
Gene ID:
Mouse(19362) RAD51 associated protein 1
Rat(689055) RAD51 associated protein 1
Zebrafish(555714) RAD51 associated protein 1
dog(611768) RAD51 associated protein 1
domestic cat(101092194) RAD51 associated protein 1
chicken(419042) RAD51 associated protein 1
domestic guinea pig(100717794) RAD51 associated protein 1
naked mole-rat(101724311) RAD51 associated protein 1
cow(615937) RAD51 associated protein 1
sheep(101112216) RAD51 associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009013 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009013 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009013 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006479 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006479 Rosetta Predictions human pricing
NM_001079711 Rosetta Predictions rat pricing
NM_009013 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106636 predicted 200
2 SASI_Hs01_00106637 predicted 416
3 SASI_Hs02_00341663 predicted 395
4 SASI_Hs01_00106638 predicted 1067
5 SASI_Hs01_00106639 predicted 1005
6 SASI_Hs01_00106640 predicted 426
7 SASI_Hs01_00106641 predicted 1089
8 SASI_Hs01_00106642 predicted 334
9 SASI_Hs02_00341664 predicted 1089
10 SASI_Hs01_00106644 predicted 260
11 SASI_Hs01_00106643 predicted 441
12 SASI_Hs01_00106645 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079711 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208109 predicted 270
2 SASI_Rn02_00208110 predicted 536
3 SASI_Rn02_00208111 predicted 1136
4 SASI_Rn02_00208112 predicted 1182
5 SASI_Rn02_00208113 predicted 268
6 SASI_Rn02_00208114 predicted 223
7 SASI_Rn02_00208115 predicted 335
8 SASI_Rn02_00208116 predicted 213
9 SASI_Rn02_00208117 predicted 226
10 SASI_Rn02_00208118 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167891 predicted 640
2 SASI_Mm02_00315163 predicted 1102
3 SASI_Mm01_00167892 predicted 337
4 SASI_Mm02_00315164 predicted 397
5 SASI_Mm01_00167894 predicted 252
6 SASI_Mm01_00167895 predicted 268
7 SASI_Mm01_00167896 predicted 938
8 SASI_Mm01_00167897 predicted 839
9 SASI_Mm01_00167898 predicted 853
10 SASI_Mm02_00315165 predicted 1120
11 SASI_Mm01_00167893 predicted 402
12 SASI_Mm01_00167899 predicted 335
13 SASI_Mm01_00167900 predicted 648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009013
VALIDATED
RAD51AP1 MISSION shRNA Bacterial Glycerol Stock
RAD51 associated protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009013.3-999s21c1
Sequence:CCGGCTCCCGATTAGCGCCAGTTAACTCGAGTTAACTGGCGCTAATCGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009013.3-637s21c1
Sequence:CCGGGAGAGTAAAGAAAGTGATGAACTCGAGTTCATCACTTTCTTTACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009013.3-1517s21c1
Sequence:CCGGAGAATCTCATGACGCTGTATGCTCGAGCATACAGCGTCATGAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009013.3-845s21c1
Sequence:CCGGCCACTAGGAAACCAGCAATAACTCGAGTTATTGCTGGTTTCCTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009013.3-105s21c1
Sequence:CCGGCAATGACTCTGATGATGATTTCTCGAGAAATCATCATCAGAGTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009013.1-789s1c1
Sequence:CCGGCCATCAAGTCAGGATCTCCATCTCGAGATGGAGATCCTGACTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009013.1-320s1c1
Sequence:CCGGCTTCCAACACTCACCAACCAACTCGAGTTGGTTGGTGAGTGTTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009013.1-844s1c1
Sequence:CCGGCACTAGGAAACCAGCAATAATCTCGAGATTATTGCTGGTTTCCTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009013.1-635s1c1
Sequence:CCGGGAGAGTAAAGAAAGTGATGAACTCGAGTTCATCACTTTCTTTACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009013
VALIDATED
RAD51AP1 MISSION shRNA shRNA Plasmid DNA
RAD51 associated protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009013.3-999s21c1
Sequence:CCGGCTCCCGATTAGCGCCAGTTAACTCGAGTTAACTGGCGCTAATCGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009013.3-637s21c1
Sequence:CCGGGAGAGTAAAGAAAGTGATGAACTCGAGTTCATCACTTTCTTTACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009013.3-1517s21c1
Sequence:CCGGAGAATCTCATGACGCTGTATGCTCGAGCATACAGCGTCATGAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009013.3-845s21c1
Sequence:CCGGCCACTAGGAAACCAGCAATAACTCGAGTTATTGCTGGTTTCCTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009013.3-105s21c1
Sequence:CCGGCAATGACTCTGATGATGATTTCTCGAGAAATCATCATCAGAGTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009013.1-789s1c1
Sequence:CCGGCCATCAAGTCAGGATCTCCATCTCGAGATGGAGATCCTGACTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009013.1-320s1c1
Sequence:CCGGCTTCCAACACTCACCAACCAACTCGAGTTGGTTGGTGAGTGTTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009013.1-844s1c1
Sequence:CCGGCACTAGGAAACCAGCAATAATCTCGAGATTATTGCTGGTTTCCTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009013.1-635s1c1
Sequence:CCGGGAGAGTAAAGAAAGTGATGAACTCGAGTTCATCACTTTCTTTACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009013
VALIDATED
RAD51AP1 MISSION shRNA Lentiviral Transduction Particles
RAD51 associated protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009013.3-999s21c1
Sequence:CCGGCTCCCGATTAGCGCCAGTTAACTCGAGTTAACTGGCGCTAATCGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009013.3-637s21c1
Sequence:CCGGGAGAGTAAAGAAAGTGATGAACTCGAGTTCATCACTTTCTTTACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009013.3-1517s21c1
Sequence:CCGGAGAATCTCATGACGCTGTATGCTCGAGCATACAGCGTCATGAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009013.3-845s21c1
Sequence:CCGGCCACTAGGAAACCAGCAATAACTCGAGTTATTGCTGGTTTCCTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009013.3-105s21c1
Sequence:CCGGCAATGACTCTGATGATGATTTCTCGAGAAATCATCATCAGAGTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009013.1-789s1c1
Sequence:CCGGCCATCAAGTCAGGATCTCCATCTCGAGATGGAGATCCTGACTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009013.1-320s1c1
Sequence:CCGGCTTCCAACACTCACCAACCAACTCGAGTTGGTTGGTGAGTGTTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009013.1-844s1c1
Sequence:CCGGCACTAGGAAACCAGCAATAATCTCGAGATTATTGCTGGTTTCCTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009013.1-635s1c1
Sequence:CCGGGAGAGTAAAGAAAGTGATGAACTCGAGTTCATCACTTTCTTTACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006479
VALIDATED
RAD51AP1 MISSION shRNA Bacterial Glycerol Stock
RAD51 associated protein 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006479.4-665s21c1
Sequence:CCGGGCAGTGATGGTGATAGTGCTACTCGAGTAGCACTATCACCATCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006479.4-184s21c1
Sequence:CCGGCCAGTCAATTACTCACAGTTTCTCGAGAAACTGTGAGTAATTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006479.4-400s21c1
Sequence:CCGGTTAGAAGTTGCACTAGCTTTACTCGAGTAAAGCTAGTGCAACTTCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006479.4-1270s21c1
Sequence:CCGGCCATTACCATGTCCTATAAATCTCGAGATTTATAGGACATGGTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006479.4-1123s21c1
Sequence:CCGGGCACGAGTTAAACCTTTGCATCTCGAGATGCAAAGGTTTAACTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006479
VALIDATED
RAD51AP1 MISSION shRNA shRNA Plasmid DNA
RAD51 associated protein 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006479.4-665s21c1
Sequence:CCGGGCAGTGATGGTGATAGTGCTACTCGAGTAGCACTATCACCATCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006479.4-184s21c1
Sequence:CCGGCCAGTCAATTACTCACAGTTTCTCGAGAAACTGTGAGTAATTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006479.4-400s21c1
Sequence:CCGGTTAGAAGTTGCACTAGCTTTACTCGAGTAAAGCTAGTGCAACTTCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006479.4-1270s21c1
Sequence:CCGGCCATTACCATGTCCTATAAATCTCGAGATTTATAGGACATGGTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006479.4-1123s21c1
Sequence:CCGGGCACGAGTTAAACCTTTGCATCTCGAGATGCAAAGGTTTAACTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006479
VALIDATED
RAD51AP1 MISSION shRNA Lentiviral Transduction Particles
RAD51 associated protein 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006479.4-665s21c1
Sequence:CCGGGCAGTGATGGTGATAGTGCTACTCGAGTAGCACTATCACCATCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006479.4-184s21c1
Sequence:CCGGCCAGTCAATTACTCACAGTTTCTCGAGAAACTGTGAGTAATTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006479.4-400s21c1
Sequence:CCGGTTAGAAGTTGCACTAGCTTTACTCGAGTAAAGCTAGTGCAACTTCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006479.4-1270s21c1
Sequence:CCGGCCATTACCATGTCCTATAAATCTCGAGATTTATAGGACATGGTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006479.4-1123s21c1
Sequence:CCGGGCACGAGTTAAACCTTTGCATCTCGAGATGCAAAGGTTTAACTCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)