EMAIL THIS PAGE TO A FRIEND

RAD51C

RAD51 paralog C

83 Gene Product Result for
Synonyms: BROVCA3 FANCO R51H3 RAD51L2
UniProtKB ID: O43502, O43503, Q3B783
Gene ID:
Human(5889) Summary: This gene is a member of the RAD51 family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51 and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with other RAD51 paralogs and is reported to be important for Holliday junction resolution. Mutations in this gene are associated with Fanconi anemia-like syndrome. This gene is one of four localized to a region of chromosome 17q23 where amplification occurs frequently in breast tumors. Overexpression of the four genes during amplification has been observed and suggests a possible role in tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(114714) RAD51 homolog C
Rat(497976) RAD51 paralog C
cow(540886) RAD51 paralog C
sheep(101106090) RAD51 homolog C (S. cerevisiae)
naked mole-rat(101714867) RAD51 homolog C (S. cerevisiae)
Domestic Rabbit(100339674) RAD51 homolog C (S. cerevisiae)
domestic guinea pig(100727310) RAD51 homolog C (S. cerevisiae)
fruit fly(35937) CG2412 gene product from transcript CG2412-RB
dog(480573) RAD51 homolog C (S. cerevisiae)
Horse(100070966) RAD51 homolog C (S. cerevisiae)
domestic cat(101096020) RAD51 homolog C (S. cerevisiae)
chicken(417626) RAD51 homolog C (S. cerevisiae)
Thale Cress(819136) DNA repair protein RAD51 homolog 3
Zebrafish(450081) rad51 homolog C (S. cerevisiae)
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002876 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053269 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053269 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053269 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002876 Rosetta Predictions human pricing
NM_058216 Rosetta Predictions human pricing
XM_001081158 Rosetta Predictions rat pricing
XM_573171 Rosetta Predictions rat pricing
NM_053269 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334651 predicted 347
2 SASI_Hs01_00204118 predicted 338
3 SASI_Hs01_00204119 predicted 318
4 SASI_Hs01_00204120 predicted 212
5 SASI_Hs01_00204122 predicted 315
6 SASI_Hs02_00334652 predicted 235
7 SASI_Hs02_00334653 predicted 302
8 SASI_Hs01_00204124 predicted 207
9 SASI_Hs01_00204125 predicted 262
10 SASI_Hs01_00204126 predicted 293
11 SASI_Hs01_00204121 predicted 238
12 SASI_Hs01_00204123 predicted 306
13 SASI_Hs01_00204127 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178845 predicted 636
2 SASI_Hs01_00178846 predicted 999
3 SASI_Hs01_00178847 predicted 737
4 SASI_Hs01_00178849 predicted 755
5 SASI_Hs01_00178850 predicted 723
6 SASI_Hs01_00178851 predicted 896
7 SASI_Hs01_00178852 predicted 212
8 SASI_Hs01_00178854 predicted 958
9 SASI_Hs02_00362135 predicted 713
10 SASI_Hs02_00362136 predicted 627
11 SASI_Hs01_00178848 predicted 700
12 SASI_Hs01_00178853 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081158 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370791 predicted 1207
2 SASI_Rn02_00370792 predicted 1035
3 SASI_Rn02_00370793 predicted 470
4 SASI_Rn02_00370794 predicted 933
5 SASI_Rn02_00370795 predicted 1001
6 SASI_Rn02_00370796 predicted 1146
7 SASI_Rn02_00370797 predicted 502
8 SASI_Rn02_00370798 predicted 880
9 SASI_Rn02_00370799 predicted 1256
10 SASI_Rn02_00370800 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573171 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399944 predicted 1666
2 SASI_Rn02_00399945 predicted 1698
3 SASI_Rn02_00399946 predicted 1670
4 SASI_Rn02_00399947 predicted 1699
5 SASI_Rn02_00399948 predicted 1695
6 SASI_Rn02_00399949 predicted 1694
7 SASI_Rn02_00399950 predicted 1699
8 SASI_Rn02_00399951 predicted 1667
9 SASI_Rn02_00399952 predicted 1202
10 SASI_Rn02_00399953 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053269 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337926 predicted 786
2 SASI_Mm02_00337927 predicted 831
3 SASI_Mm02_00337928 predicted 349
4 SASI_Mm02_00337929 predicted 731
5 SASI_Mm02_00337930 predicted 384
6 SASI_Mm02_00337931 predicted 702
7 SASI_Mm02_00337932 predicted 809
8 SASI_Mm02_00337933 predicted 746
9 SASI_Mm02_00337934 predicted 1581
10 SASI_Mm02_00337935 predicted 915
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002876
VALIDATED
RAD51C MISSION shRNA Bacterial Glycerol Stock
RAD51 paralog C
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002876.2-208s1c1
Sequence:CCGGGAAGCCTTAGAAACTCTGCAACTCGAGTTGCAGAGTTTCTAAGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002876.2-234s1c1
Sequence:CCGGCAGAAGAGAATGTCTCACAAACTCGAGTTTGTGAGACATTCTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002876.2-278s1c1
Sequence:CCGGCTGAGTCACACAAGAAGTGTACTCGAGTACACTTCTTGTGTGACTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002876.2-182s1c1
Sequence:CCGGGCAAAGAAGTTGGGATATCTACTCGAGTAGATATCCCAACTTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002876.2-335s1c1
Sequence:CCGGGCTTCATAATCACCTTCTGTTCTCGAGAACAGAAGGTGATTATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002876.2-190s1c1
Sequence:CCGGGTTGGGATATCTAAAGCAGAACTCGAGTTCTGCTTTAGATATCCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002876.2-177s1c1
Sequence:CCGGGCTTAGCAAAGAAGTTGGGATCTCGAGATCCCAACTTCTTTGCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002876.2-323s21c1
Sequence:CCGGAGCATACCCAGGGCTTCATAACTCGAGTTATGAAGCCCTGGGTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002876.2-234s21c1
Sequence:CCGGCAGAAGAGAATGTCTCACAAACTCGAGTTTGTGAGACATTCTCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002876.2-190s21c1
Sequence:CCGGGTTGGGATATCTAAAGCAGAACTCGAGTTCTGCTTTAGATATCCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002876.2-182s21c1
Sequence:CCGGGCAAAGAAGTTGGGATATCTACTCGAGTAGATATCCCAACTTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002876
VALIDATED
RAD51C MISSION shRNA shRNA Plasmid DNA
RAD51 paralog C
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002876.2-208s1c1
Sequence:CCGGGAAGCCTTAGAAACTCTGCAACTCGAGTTGCAGAGTTTCTAAGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002876.2-234s1c1
Sequence:CCGGCAGAAGAGAATGTCTCACAAACTCGAGTTTGTGAGACATTCTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002876.2-278s1c1
Sequence:CCGGCTGAGTCACACAAGAAGTGTACTCGAGTACACTTCTTGTGTGACTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002876.2-182s1c1
Sequence:CCGGGCAAAGAAGTTGGGATATCTACTCGAGTAGATATCCCAACTTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002876.2-335s1c1
Sequence:CCGGGCTTCATAATCACCTTCTGTTCTCGAGAACAGAAGGTGATTATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002876.2-190s1c1
Sequence:CCGGGTTGGGATATCTAAAGCAGAACTCGAGTTCTGCTTTAGATATCCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002876.2-177s1c1
Sequence:CCGGGCTTAGCAAAGAAGTTGGGATCTCGAGATCCCAACTTCTTTGCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002876.2-323s21c1
Sequence:CCGGAGCATACCCAGGGCTTCATAACTCGAGTTATGAAGCCCTGGGTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002876.2-234s21c1
Sequence:CCGGCAGAAGAGAATGTCTCACAAACTCGAGTTTGTGAGACATTCTCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002876.2-190s21c1
Sequence:CCGGGTTGGGATATCTAAAGCAGAACTCGAGTTCTGCTTTAGATATCCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002876.2-182s21c1
Sequence:CCGGGCAAAGAAGTTGGGATATCTACTCGAGTAGATATCCCAACTTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002876
VALIDATED
RAD51C MISSION shRNA Lentiviral Transduction Particles
RAD51 paralog C
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002876.2-208s1c1
Sequence:CCGGGAAGCCTTAGAAACTCTGCAACTCGAGTTGCAGAGTTTCTAAGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002876.2-234s1c1
Sequence:CCGGCAGAAGAGAATGTCTCACAAACTCGAGTTTGTGAGACATTCTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002876.2-278s1c1
Sequence:CCGGCTGAGTCACACAAGAAGTGTACTCGAGTACACTTCTTGTGTGACTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002876.2-182s1c1
Sequence:CCGGGCAAAGAAGTTGGGATATCTACTCGAGTAGATATCCCAACTTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002876.2-335s1c1
Sequence:CCGGGCTTCATAATCACCTTCTGTTCTCGAGAACAGAAGGTGATTATGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002876.2-190s1c1
Sequence:CCGGGTTGGGATATCTAAAGCAGAACTCGAGTTCTGCTTTAGATATCCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002876.2-177s1c1
Sequence:CCGGGCTTAGCAAAGAAGTTGGGATCTCGAGATCCCAACTTCTTTGCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002876.2-323s21c1
Sequence:CCGGAGCATACCCAGGGCTTCATAACTCGAGTTATGAAGCCCTGGGTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002876.2-234s21c1
Sequence:CCGGCAGAAGAGAATGTCTCACAAACTCGAGTTTGTGAGACATTCTCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002876.2-190s21c1
Sequence:CCGGGTTGGGATATCTAAAGCAGAACTCGAGTTCTGCTTTAGATATCCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002876.2-182s21c1
Sequence:CCGGGCAAAGAAGTTGGGATATCTACTCGAGTAGATATCCCAACTTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053269
VALIDATED
RAD51C MISSION shRNA Bacterial Glycerol Stock
RAD51 paralog C
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053269.1-895s1c1
Sequence:CCGGGCTGCTACAATAAGGCTCATTCTCGAGAATGAGCCTTATTGTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053269.1-108s1c1
Sequence:CCGGGCTCAGCAAAGAAGTTGGGATCTCGAGATCCCAACTTCTTTGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053269.1-740s1c1
Sequence:CCGGCCCTTCGTACTCGATTACTAACTCGAGTTAGTAATCGAGTACGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053269.1-684s1c1
Sequence:CCGGGCTAGTGATAATAGACGGAATCTCGAGATTCCGTCTATTATCACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053269.1-261s1c1
Sequence:CCGGCCAGGGCTTCATAATCACCTTCTCGAGAAGGTGATTATGAAGCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053269.3-902s21c1
Sequence:CCGGGATGACAACAAAGATTGATAACTCGAGTTATCAATCTTTGTTGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053269.3-335s21c1
Sequence:CCGGCCAGGGCTTCATAATCACCTTCTCGAGAAGGTGATTATGAAGCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053269.3-814s21c1
Sequence:CCGGCCCTTCGTACTCGATTACTAACTCGAGTTAGTAATCGAGTACGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053269.3-1067s21c1
Sequence:CCGGGATCACACCTCAGGGATTTAGCTCGAGCTAAATCCCTGAGGTGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053269
VALIDATED
RAD51C MISSION shRNA shRNA Plasmid DNA
RAD51 paralog C
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053269.1-895s1c1
Sequence:CCGGGCTGCTACAATAAGGCTCATTCTCGAGAATGAGCCTTATTGTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053269.1-108s1c1
Sequence:CCGGGCTCAGCAAAGAAGTTGGGATCTCGAGATCCCAACTTCTTTGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053269.1-740s1c1
Sequence:CCGGCCCTTCGTACTCGATTACTAACTCGAGTTAGTAATCGAGTACGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053269.1-684s1c1
Sequence:CCGGGCTAGTGATAATAGACGGAATCTCGAGATTCCGTCTATTATCACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053269.1-261s1c1
Sequence:CCGGCCAGGGCTTCATAATCACCTTCTCGAGAAGGTGATTATGAAGCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053269.3-902s21c1
Sequence:CCGGGATGACAACAAAGATTGATAACTCGAGTTATCAATCTTTGTTGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053269.3-335s21c1
Sequence:CCGGCCAGGGCTTCATAATCACCTTCTCGAGAAGGTGATTATGAAGCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053269.3-814s21c1
Sequence:CCGGCCCTTCGTACTCGATTACTAACTCGAGTTAGTAATCGAGTACGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053269.3-1067s21c1
Sequence:CCGGGATCACACCTCAGGGATTTAGCTCGAGCTAAATCCCTGAGGTGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053269
VALIDATED
RAD51C MISSION shRNA Lentiviral Transduction Particles
RAD51 paralog C
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053269.1-895s1c1
Sequence:CCGGGCTGCTACAATAAGGCTCATTCTCGAGAATGAGCCTTATTGTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_053269.1-108s1c1
Sequence:CCGGGCTCAGCAAAGAAGTTGGGATCTCGAGATCCCAACTTCTTTGCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053269.1-740s1c1
Sequence:CCGGCCCTTCGTACTCGATTACTAACTCGAGTTAGTAATCGAGTACGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053269.1-684s1c1
Sequence:CCGGGCTAGTGATAATAGACGGAATCTCGAGATTCCGTCTATTATCACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053269.1-261s1c1
Sequence:CCGGCCAGGGCTTCATAATCACCTTCTCGAGAAGGTGATTATGAAGCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053269.3-902s21c1
Sequence:CCGGGATGACAACAAAGATTGATAACTCGAGTTATCAATCTTTGTTGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053269.3-335s21c1
Sequence:CCGGCCAGGGCTTCATAATCACCTTCTCGAGAAGGTGATTATGAAGCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053269.3-814s21c1
Sequence:CCGGCCCTTCGTACTCGATTACTAACTCGAGTTAGTAATCGAGTACGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_053269.3-1067s21c1
Sequence:CCGGGATCACACCTCAGGGATTTAGCTCGAGCTAAATCCCTGAGGTGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)