EMAIL THIS PAGE TO A FRIEND

RAD54B

RAD54 homolog B (S. cerevisiae)

87 Gene Product Result for
Synonyms: RDH54
UniProtKB ID: Q9Y620, F6WBS8
Gene ID:
Human(25788) Summary: The protein encoded by this gene belongs to the DEAD-like helicase superfamily. It shares similarity with Saccharomyces cerevisiae RAD54 and RDH54, both of which are involved in homologous recombination and repair of DNA. This protein binds to double-stranded DNA, and displays ATPase activity in the presence of DNA. This gene is highly expressed in testis and spleen, which suggests active roles in meiotic and mitotic recombination. Homozygous mutations of this gene were observed in primary lymphoma and colon cancer. [provided by RefSeq, Jul 2008]
Mouse(623474) RAD54 homolog B (S. cerevisiae)
Rat(313063) RAD54 homolog B (S. cerevisiae)
Zebrafish(560482) RAD54 homolog B (S. cerevisiae)
chicken(395449) RAD54 homolog B (S. cerevisiae)
dog(487053) RAD54 homolog B (S. cerevisiae)
domestic cat(101083740) RAD54 homolog B (S. cerevisiae)
Horse(100146782) RAD54 homolog B (S. cerevisiae)
domestic guinea pig(100734409) RAD54 homolog B (S. cerevisiae)
naked mole-rat(101697859) RAD54 homolog B (S. cerevisiae)
Domestic Rabbit(100354266) RAD54 homolog B (S. cerevisiae)
cow(533414) RAD54 homolog B (S. cerevisiae)
sheep(101110770) RAD54 homolog B (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012415 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039556 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039556 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039556 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012415 Rosetta Predictions human pricing
XM_001054095 Rosetta Predictions rat pricing
XM_232785 Rosetta Predictions rat pricing
NM_001039556 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158216 predicted 1949
2 SASI_Hs01_00158217 predicted 1332
3 SASI_Hs01_00158220 predicted 735
4 SASI_Hs02_00344270 predicted 1057
5 SASI_Hs01_00158222 predicted 1904
6 SASI_Hs02_00344271 predicted 887
7 SASI_Hs02_00344272 predicted 680
8 SASI_Hs01_00158225 predicted 1094
9 SASI_Hs02_00344273 predicted 2694
10 SASI_Hs02_00344274 predicted 1160
11 SASI_Hs01_00158218 predicted 1752
12 SASI_Hs01_00158219 predicted 1244
13 SASI_Hs01_00158221 predicted 2681
14 SASI_Hs01_00158223 predicted 973
15 SASI_Hs01_00158224 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274726 predicted 1940
2 SASI_Rn02_00274727 predicted 791
3 SASI_Rn02_00274728 predicted 1269
4 SASI_Rn02_00274729 predicted 1471
5 SASI_Rn02_00274730 predicted 2024
6 SASI_Rn02_00274731 predicted 2122
7 SASI_Rn02_00274732 predicted 1676
8 SASI_Rn02_00274733 predicted 1256
9 SASI_Rn02_00274734 predicted 955
10 SASI_Rn02_00274735 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387245 predicted 1857
2 SASI_Rn02_00387246 predicted 708
3 SASI_Rn02_00387247 predicted 1191
4 SASI_Rn02_00387248 predicted 1391
5 SASI_Rn02_00387249 predicted 1939
6 SASI_Rn02_00387250 predicted 2038
7 SASI_Rn02_00387251 predicted 1594
8 SASI_Rn02_00387252 predicted 1171
9 SASI_Rn02_00387253 predicted 872
10 SASI_Rn02_00387254 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047520 predicted 830
2 SASI_Mm01_00047521 predicted 794
3 SASI_Mm01_00047522 predicted 1668
4 SASI_Mm01_00047523 predicted 2098
5 SASI_Mm01_00047524 predicted 2170
6 SASI_Mm01_00047525 predicted 847
7 SASI_Mm01_00047526 predicted 920
8 SASI_Mm01_00047527 predicted 1645
9 SASI_Mm02_00290142 predicted 2318
10 SASI_Mm01_00047528 predicted 2221
11 SASI_Mm01_00047529 predicted 1750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012415
VALIDATED
RAD54B MISSION shRNA Bacterial Glycerol Stock
RAD54 homolog B (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012415.2-1144s21c1
Sequence:CCGGATGGAGGCAAGCCAGTAATAACTCGAGTTATTACTGGCTTGCCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012415.2-2847s21c1
Sequence:CCGGGACATTCCATTGCTCTTCTTTCTCGAGAAAGAAGAGCAATGGAATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012415.2-366s21c1
Sequence:CCGGGCACCTACACTGGCAACATTACTCGAGTAATGTTGCCAGTGTAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012415.2-862s21c1
Sequence:CCGGATGACCCATATACGCCAAATTCTCGAGAATTTGGCGTATATGGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012415.2-1338s21c1
Sequence:CCGGCTTCGTTCCCTGGATCAAATTCTCGAGAATTTGATCCAGGGAACGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012415.2-2669s1c1
Sequence:CCGGCCAGAAATCTAACTCCCTGAACTCGAGTTCAGGGAGTTAGATTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012415.2-1345s1c1
Sequence:CCGGCCCTGGATCAAATTAAGAATACTCGAGTATTCTTAATTTGATCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_012415.2-2198s1c1
Sequence:CCGGGCAGATTGTTGATGGCTTTAACTCGAGTTAAAGCCATCAACAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012415.2-1769s1c1
Sequence:CCGGGCTTTATCGAAAGCTGTTAAACTCGAGTTTAACAGCTTTCGATAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012415.2-378s1c1
Sequence:CCGGGCAACATTAGATCCACCTCATCTCGAGATGAGGTGGATCTAATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012415
VALIDATED
RAD54B MISSION shRNA shRNA Plasmid DNA
RAD54 homolog B (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012415.2-1144s21c1
Sequence:CCGGATGGAGGCAAGCCAGTAATAACTCGAGTTATTACTGGCTTGCCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012415.2-2847s21c1
Sequence:CCGGGACATTCCATTGCTCTTCTTTCTCGAGAAAGAAGAGCAATGGAATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012415.2-366s21c1
Sequence:CCGGGCACCTACACTGGCAACATTACTCGAGTAATGTTGCCAGTGTAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012415.2-862s21c1
Sequence:CCGGATGACCCATATACGCCAAATTCTCGAGAATTTGGCGTATATGGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012415.2-1338s21c1
Sequence:CCGGCTTCGTTCCCTGGATCAAATTCTCGAGAATTTGATCCAGGGAACGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012415.2-2669s1c1
Sequence:CCGGCCAGAAATCTAACTCCCTGAACTCGAGTTCAGGGAGTTAGATTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012415.2-1345s1c1
Sequence:CCGGCCCTGGATCAAATTAAGAATACTCGAGTATTCTTAATTTGATCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_012415.2-2198s1c1
Sequence:CCGGGCAGATTGTTGATGGCTTTAACTCGAGTTAAAGCCATCAACAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012415.2-1769s1c1
Sequence:CCGGGCTTTATCGAAAGCTGTTAAACTCGAGTTTAACAGCTTTCGATAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012415.2-378s1c1
Sequence:CCGGGCAACATTAGATCCACCTCATCTCGAGATGAGGTGGATCTAATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012415
VALIDATED
RAD54B MISSION shRNA Lentiviral Transduction Particles
RAD54 homolog B (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012415.2-1144s21c1
Sequence:CCGGATGGAGGCAAGCCAGTAATAACTCGAGTTATTACTGGCTTGCCTCCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000330066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012415.2-2847s21c1
Sequence:CCGGGACATTCCATTGCTCTTCTTTCTCGAGAAAGAAGAGCAATGGAATGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000330064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012415.2-366s21c1
Sequence:CCGGGCACCTACACTGGCAACATTACTCGAGTAATGTTGCCAGTGTAGGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000330063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012415.2-862s21c1
Sequence:CCGGATGACCCATATACGCCAAATTCTCGAGAATTTGGCGTATATGGGTCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000330065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012415.2-1338s21c1
Sequence:CCGGCTTCGTTCCCTGGATCAAATTCTCGAGAATTTGATCCAGGGAACGAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000051308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012415.2-2669s1c1
Sequence:CCGGCCAGAAATCTAACTCCCTGAACTCGAGTTCAGGGAGTTAGATTTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000051310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012415.2-1345s1c1
Sequence:CCGGCCCTGGATCAAATTAAGAATACTCGAGTATTCTTAATTTGATCCAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000051312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_012415.2-2198s1c1
Sequence:CCGGGCAGATTGTTGATGGCTTTAACTCGAGTTAAAGCCATCAACAATCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000051311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012415.2-1769s1c1
Sequence:CCGGGCTTTATCGAAAGCTGTTAAACTCGAGTTTAACAGCTTTCGATAAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000051309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012415.2-378s1c1
Sequence:CCGGGCAACATTAGATCCACCTCATCTCGAGATGAGGTGGATCTAATGTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039556
VALIDATED
RAD54B MISSION shRNA Bacterial Glycerol Stock
RAD54 homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039556.2-1436s21c1
Sequence:CCGGTTAGGGTCTCTGTCGTCTTACCTCGAGGTAAGACGACAGAGACCCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039556.2-2700s21c1
Sequence:CCGGACCAAGCTCCTGCCGTCTAATCTCGAGATTAGACGGCAGGAGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039556.2-801s21c1
Sequence:CCGGAGAATCACCAGCGGATGTTTACTCGAGTAAACATCCGCTGGTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039556.2-1152s21c1
Sequence:CCGGCCGTTGATCAGGACCATAAAGCTCGAGCTTTATGGTCCTGATCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039556.2-1233s21c1
Sequence:CCGGTTCGTTCCCTAGATCAAATTACTCGAGTAATTTGATCTAGGGAACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039556
VALIDATED
RAD54B MISSION shRNA shRNA Plasmid DNA
RAD54 homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039556.2-1436s21c1
Sequence:CCGGTTAGGGTCTCTGTCGTCTTACCTCGAGGTAAGACGACAGAGACCCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039556.2-2700s21c1
Sequence:CCGGACCAAGCTCCTGCCGTCTAATCTCGAGATTAGACGGCAGGAGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039556.2-801s21c1
Sequence:CCGGAGAATCACCAGCGGATGTTTACTCGAGTAAACATCCGCTGGTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039556.2-1152s21c1
Sequence:CCGGCCGTTGATCAGGACCATAAAGCTCGAGCTTTATGGTCCTGATCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039556.2-1233s21c1
Sequence:CCGGTTCGTTCCCTAGATCAAATTACTCGAGTAATTTGATCTAGGGAACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039556
VALIDATED
RAD54B MISSION shRNA Lentiviral Transduction Particles
RAD54 homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039556.2-1436s21c1
Sequence:CCGGTTAGGGTCTCTGTCGTCTTACCTCGAGGTAAGACGACAGAGACCCTAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000239972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039556.2-2700s21c1
Sequence:CCGGACCAAGCTCCTGCCGTCTAATCTCGAGATTAGACGGCAGGAGCTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000239969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039556.2-801s21c1
Sequence:CCGGAGAATCACCAGCGGATGTTTACTCGAGTAAACATCCGCTGGTGATTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000239973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039556.2-1152s21c1
Sequence:CCGGCCGTTGATCAGGACCATAAAGCTCGAGCTTTATGGTCCTGATCAACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000239970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039556.2-1233s21c1
Sequence:CCGGTTCGTTCCCTAGATCAAATTACTCGAGTAATTTGATCTAGGGAACGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???