EMAIL THIS PAGE TO A FRIEND

RAD9A

RAD9 homolog A (S. pombe)

96 Gene Product Result for
Synonyms: RAD9
UniProtKB ID: Q99638, B2RCZ8, Q6FI29, Q96C41
Gene ID:
Human(5883) Summary: This gene product is highly similar to Schizosaccharomyces pombe rad9, a cell cycle checkpoint protein required for cell cycle arrest and DNA damage repair. This protein possesses 3' to 5' exonuclease activity, which may contribute to its role in sensing and repairing DNA damage. It forms a checkpoint protein complex with RAD1 and HUS1. This complex is recruited by checkpoint protein RAD17 to the sites of DNA damage, which is thought to be important for triggering the checkpoint-signaling cascade. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(19367) RAD9 homolog A
Rat(100361529) RAD9 homolog A (S. pombe)
Zebrafish(563903) RAD9 homolog A
chicken(404777) RAD9 homolog A (S. pombe)
dog(483696) RAD9 homolog A (S. pombe)
domestic cat(101101590) RAD9 homolog A (S. pombe)
domestic guinea pig(100721417) RAD9 homolog A (S. pombe)
naked mole-rat(101704571) RAD9 homolog A (S. pombe)
cow(504647) RAD9 homolog A (S. pombe)
sheep(101119002) RAD9 homolog A (S. pombe)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306310 ANTI-PHOSPHO-RAD9(S272) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306311 ANTI-PHOSPHO-RAD9(S277) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1305632 ANTI-PHOSPHO-RAD9(S328) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306312 ANTI-PHOSPHO-RAD9(S387) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1305995 ANTI-PHOSPHO-RAD9(Y28) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1306241 ANTI-RAD9 (BH3 DOMAIN SPECIFIC) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB1306013 ANTI-RAD9 (CENTER L265) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1306578 ANTI-RAD9 (S387) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
R7404 Anti-RAD9 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2500858 Anti-RAD9A antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, canine
ELISA, western blot pricing
HPA006725 Anti-RAD9A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
SAB2101941 Anti-RAD9A antibody produced in rabbit affinity isolated antibody rat, horse, human
western blot pricing
HPA048155 Anti-RAD9A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
PLA0151 Rabbit anti-Rad9 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. dog, rhesus monkey, gibbon, human, marmoset, gorilla, pig, bovine, ferret
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004584 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011237 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011237 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011237 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004584 Rosetta Predictions human pricing
NM_011237 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195393 predicted 1487
2 SASI_Hs01_00195394 predicted 1532
3 SASI_Hs01_00195395 predicted 1473
4 SASI_Hs01_00195396 predicted 1533
5 SASI_Hs01_00195398 predicted 781
6 SASI_Hs01_00195400 predicted 992
7 SASI_Hs01_00195401 predicted 307
8 SASI_Hs01_00195402 predicted 738
9 SASI_Hs02_00337932 predicted 1502
10 SASI_Hs02_00337933 predicted 1726
11 SASI_Hs01_00195397 predicted 321
12 SASI_Hs01_00195399 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011237 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320204 predicted 300
2 SASI_Mm01_00071616 predicted 871
3 SASI_Mm01_00071617 predicted 1507
4 SASI_Mm01_00071618 predicted 1149
5 SASI_Mm01_00071619 predicted 1323
6 SASI_Mm01_00071620 predicted 963
7 SASI_Mm01_00071621 predicted 1466
8 SASI_Mm01_00071622 predicted 1252
9 SASI_Mm01_00071623 predicted 984
10 SASI_Mm01_00071624 predicted 963
11 SASI_Mm01_00071615 predicted 1257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004584
RAD9A MISSION shRNA Bacterial Glycerol Stock
RAD9 homolog A (S. pombe)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004584.2-450s1c1
Sequence:CCGGGAAGACTCACAACCTGTCCTTCTCGAGAAGGACAGGTTGTGAGTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004584.2-996s1c1
Sequence:CCGGCGACATTGACTCTTACATGATCTCGAGATCATGTAAGAGTCAATGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004584.2-787s1c1
Sequence:CCGGGCAAACTTGAATCTTAGCATTCTCGAGAATGCTAAGATTCAAGTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004584.2-1243s1c1
Sequence:CCGGGCGGAAGACAGTGAGGGTGAACTCGAGTTCACCCTCACTGTCTTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004584.2-255s1c1
Sequence:CCGGCCCGCTCTTCTTCCAGCAATACTCGAGTATTGCTGGAAGAAGAGCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004584.2-1739s21c1
Sequence:CCGGGATACTCTTTGGCGCTGACTTCTCGAGAAGTCAGCGCCAAAGAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004584.2-685s21c1
Sequence:CCGGTGCCTTGGAGAGGAGGATTTCCTCGAGGAAATCCTCCTCTCCAAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004584
RAD9A MISSION shRNA shRNA Plasmid DNA
RAD9 homolog A (S. pombe)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004584.2-450s1c1
Sequence:CCGGGAAGACTCACAACCTGTCCTTCTCGAGAAGGACAGGTTGTGAGTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004584.2-996s1c1
Sequence:CCGGCGACATTGACTCTTACATGATCTCGAGATCATGTAAGAGTCAATGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004584.2-787s1c1
Sequence:CCGGGCAAACTTGAATCTTAGCATTCTCGAGAATGCTAAGATTCAAGTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004584.2-1243s1c1
Sequence:CCGGGCGGAAGACAGTGAGGGTGAACTCGAGTTCACCCTCACTGTCTTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004584.2-255s1c1
Sequence:CCGGCCCGCTCTTCTTCCAGCAATACTCGAGTATTGCTGGAAGAAGAGCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004584.2-1739s21c1
Sequence:CCGGGATACTCTTTGGCGCTGACTTCTCGAGAAGTCAGCGCCAAAGAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004584.2-685s21c1
Sequence:CCGGTGCCTTGGAGAGGAGGATTTCCTCGAGGAAATCCTCCTCTCCAAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004584
RAD9A MISSION shRNA Lentiviral Transduction Particles
RAD9 homolog A (S. pombe)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004584.2-450s1c1
Sequence:CCGGGAAGACTCACAACCTGTCCTTCTCGAGAAGGACAGGTTGTGAGTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004584.2-996s1c1
Sequence:CCGGCGACATTGACTCTTACATGATCTCGAGATCATGTAAGAGTCAATGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004584.2-787s1c1
Sequence:CCGGGCAAACTTGAATCTTAGCATTCTCGAGAATGCTAAGATTCAAGTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004584.2-1243s1c1
Sequence:CCGGGCGGAAGACAGTGAGGGTGAACTCGAGTTCACCCTCACTGTCTTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004584.2-255s1c1
Sequence:CCGGCCCGCTCTTCTTCCAGCAATACTCGAGTATTGCTGGAAGAAGAGCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004584.2-1739s21c1
Sequence:CCGGGATACTCTTTGGCGCTGACTTCTCGAGAAGTCAGCGCCAAAGAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004584.2-685s21c1
Sequence:CCGGTGCCTTGGAGAGGAGGATTTCCTCGAGGAAATCCTCCTCTCCAAGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011237
VALIDATED
RAD9A MISSION shRNA Bacterial Glycerol Stock
RAD9 homolog A (S. pombe)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011237.1-300s1c1
Sequence:CCGGGCGCTGTAAGATCCTGATGAACTCGAGTTCATCAGGATCTTACAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011237.1-965s1c1
Sequence:CCGGCCCACTTAGATGACTTTACCACTCGAGTGGTAAAGTCATCTAAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011237.1-249s1c1
Sequence:CCGGCCCACTCTTCTTCCAGCAGTACTCGAGTACTGCTGGAAGAAGAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011237.1-790s1c1
Sequence:CCGGCCTCTTACTATCCACTTCGATCTCGAGATCGAAGTGGATAGTAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011237.1-1332s1c1
Sequence:CCGGCCTTAGACATGGACATGGAAACTCGAGTTTCCATGTCCATGTCTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011237.2-1241s21c1
Sequence:CCGGGTGATGGTGAAGGGTGAATTTCTCGAGAAATTCACCCTTCACCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011237.2-1661s21c1
Sequence:CCGGCCTTGGCCTAGAATCCTAATACTCGAGTATTAGGATTCTAGGCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011237.2-992s21c1
Sequence:CCGGACATTGACTGTTACATGATTGCTCGAGCAATCATGTAACAGTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011237.2-501s21c1
Sequence:CCGGAGCCTCATGCCCTCACTTATTCTCGAGAATAAGTGAGGGCATGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011237.2-820s21c1
Sequence:CCGGAGGCCAGTCATCTTTACTATTCTCGAGAATAGTAAAGATGACTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011237
VALIDATED
RAD9A MISSION shRNA shRNA Plasmid DNA
RAD9 homolog A (S. pombe)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011237.1-300s1c1
Sequence:CCGGGCGCTGTAAGATCCTGATGAACTCGAGTTCATCAGGATCTTACAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011237.1-965s1c1
Sequence:CCGGCCCACTTAGATGACTTTACCACTCGAGTGGTAAAGTCATCTAAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011237.1-249s1c1
Sequence:CCGGCCCACTCTTCTTCCAGCAGTACTCGAGTACTGCTGGAAGAAGAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011237.1-790s1c1
Sequence:CCGGCCTCTTACTATCCACTTCGATCTCGAGATCGAAGTGGATAGTAAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011237.1-1332s1c1
Sequence:CCGGCCTTAGACATGGACATGGAAACTCGAGTTTCCATGTCCATGTCTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011237.2-1241s21c1
Sequence:CCGGGTGATGGTGAAGGGTGAATTTCTCGAGAAATTCACCCTTCACCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011237.2-1661s21c1
Sequence:CCGGCCTTGGCCTAGAATCCTAATACTCGAGTATTAGGATTCTAGGCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011237.2-992s21c1
Sequence:CCGGACATTGACTGTTACATGATTGCTCGAGCAATCATGTAACAGTCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011237.2-501s21c1
Sequence:CCGGAGCCTCATGCCCTCACTTATTCTCGAGAATAAGTGAGGGCATGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011237.2-820s21c1
Sequence:CCGGAGGCCAGTCATCTTTACTATTCTCGAGAATAGTAAAGATGACTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011237
VALIDATED
RAD9A MISSION shRNA Lentiviral Transduction Particles
RAD9 homolog A (S. pombe)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011237.1-300s1c1
Sequence:CCGGGCGCTGTAAGATCCTGATGAACTCGAGTTCATCAGGATCTTACAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011237.1-965s1c1
Sequence:CCGGCCCACTTAGATGACTTTACCACTCGAGTGGTAAAGTCATCTAAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011237.1-249s1c1
Sequence:CCGGCCCACTCTTCTTCCAGCAGTACTCGAGTACTGCTGGAAGAAGAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011237.1-790s1c1
Sequence:CCGGCCTCTTACTATCCACTTCGATCTCGAGATCGAAGTGGATAGTAAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011237.1-1332s1c1
Sequence:CCGGCCTTAGACATGGACATGGAAACTCGAGTTTCCATGTCCATGTCTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011237.2-1241s21c1
Sequence:CCGGGTGATGGTGAAGGGTGAATTTCTCGAGAAATTCACCCTTCACCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011237.2-1661s21c1
Sequence:CCGGCCTTGGCCTAGAATCCTAATACTCGAGTATTAGGATTCTAGGCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011237.2-992s21c1
Sequence:CCGGACATTGACTGTTACATGATTGCTCGAGCAATCATGTAACAGTCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011237.2-501s21c1
Sequence:CCGGAGCCTCATGCCCTCACTTATTCTCGAGAATAAGTGAGGGCATGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011237.2-820s21c1
Sequence:CCGGAGGCCAGTCATCTTTACTATTCTCGAGAATAGTAAAGATGACTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)