EMAIL THIS PAGE TO A FRIEND

RAD9B

RAD9 homolog B (S. pombe)

91 Gene Product Result for
UniProtKB ID: Q6WBX8, Q5U5K0, Q6NVJ1, Q6ZVT7, Q8N7T9, Q96LI8
Gene ID:
Mouse(231724) RAD9 homolog B
Rat(363924) RAD9 homolog B (S. pombe)
cow(616597) RAD9 homolog B (S. pombe)
sheep(101105531) RAD9 homolog B (S. pombe)
naked mole-rat(101716809) RAD9 homolog B (S. pombe)
domestic guinea pig(100717993) RAD9 homolog B (S. pombe)
chicken(416868) RAD9 homolog B (S. pombe)
domestic cat(101100089) RAD9 homolog B (S. pombe)
dog(610864) RAD9 homolog B (S. pombe)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152442 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144912 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144912 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144912 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152442 Rosetta Predictions human pricing
NM_001030042 Rosetta Predictions rat pricing
NM_144912 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366193 predicted 497
2 SASI_Hs02_00366194 predicted 322
3 SASI_Hs02_00366195 predicted 531
4 SASI_Hs02_00366196 predicted 722
5 SASI_Hs02_00366197 predicted 333
6 SASI_Hs02_00366198 predicted 271
7 SASI_Hs01_00180047 predicted 928
8 SASI_Hs02_00366199 predicted 222
9 SASI_Hs01_00180048 predicted 823
10 SASI_Hs02_00366200 predicted 593
11 SASI_Hs01_00180045 predicted 1437
12 SASI_Hs01_00180046 predicted 818
13 SASI_Hs01_00180049 predicted 1159
14 SASI_Hs01_00180050 predicted 928
15 SASI_Hs01_00180051 predicted 1160
16 SASI_Hs01_00180052 predicted 1268
17 SASI_Hs01_00180053 predicted 1180
18 SASI_Hs01_00180054 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093619 predicted 1343
2 SASI_Rn01_00093620 predicted 646
3 SASI_Rn01_00093621 predicted 360
4 SASI_Rn01_00093622 predicted 712
5 SASI_Rn02_00203553 predicted 522
6 SASI_Rn01_00093623 predicted 584
7 SASI_Rn01_00093624 predicted 390
8 SASI_Rn01_00093625 predicted 345
9 SASI_Rn01_00093626 predicted 1323
10 SASI_Rn01_00093627 predicted 400
11 SASI_Rn01_00093628 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119149 predicted 277
2 SASI_Mm02_00340394 predicted 530
3 SASI_Mm01_00119150 predicted 813
4 SASI_Mm01_00119151 predicted 826
5 SASI_Mm01_00119153 predicted 242
6 SASI_Mm01_00119154 predicted 459
7 SASI_Mm01_00119155 predicted 345
8 SASI_Mm01_00119156 predicted 543
9 SASI_Mm02_00340395 predicted 739
10 SASI_Mm01_00119157 predicted 821
11 SASI_Mm01_00119148 predicted 1063
12 SASI_Mm01_00119152 predicted 602
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152442
RAD9B MISSION shRNA Bacterial Glycerol Stock
RAD9 homolog B (S. pombe)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152442.2-733s1c1
Sequence:CCGGCTTGCTGTTACTCCACTGAATCTCGAGATTCAGTGGAGTAACAGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152442.2-799s1c1
Sequence:CCGGGCTGTACACAGTGAGATGTTTCTCGAGAAACATCTCACTGTGTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152442.2-854s1c1
Sequence:CCGGGAATGGACACTGAGATAACATCTCGAGATGTTATCTCAGTGTCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152442.2-1798s1c1
Sequence:CCGGGCCATCAAGATGGCTTGAAATCTCGAGATTTCAAGCCATCTTGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152442.2-1012s1c1
Sequence:CCGGGCCACATTAGCTGATGAACAACTCGAGTTGTTCATCAGCTAATGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152442.2-1325s1c1
Sequence:CCGGGCATGTTCTTTGGAGCAGTTTCTCGAGAAACTGCTCCAAAGAACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152442.2-811s1c1
Sequence:CCGGGAGATGTTTGTTGGCTCAGATCTCGAGATCTGAGCCAACAAACATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152442.2-2143s1c1
Sequence:CCGGGCCTGGCTAATTTCTGGTATTCTCGAGAATACCAGAAATTAGCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152442.2-2453s1c1
Sequence:CCGGGCCTGAGTTTGGAGTGGAATACTCGAGTATTCCACTCCAAACTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152442
RAD9B MISSION shRNA shRNA Plasmid DNA
RAD9 homolog B (S. pombe)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152442.2-733s1c1
Sequence:CCGGCTTGCTGTTACTCCACTGAATCTCGAGATTCAGTGGAGTAACAGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152442.2-799s1c1
Sequence:CCGGGCTGTACACAGTGAGATGTTTCTCGAGAAACATCTCACTGTGTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152442.2-854s1c1
Sequence:CCGGGAATGGACACTGAGATAACATCTCGAGATGTTATCTCAGTGTCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152442.2-1798s1c1
Sequence:CCGGGCCATCAAGATGGCTTGAAATCTCGAGATTTCAAGCCATCTTGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152442.2-1012s1c1
Sequence:CCGGGCCACATTAGCTGATGAACAACTCGAGTTGTTCATCAGCTAATGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152442.2-1325s1c1
Sequence:CCGGGCATGTTCTTTGGAGCAGTTTCTCGAGAAACTGCTCCAAAGAACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152442.2-811s1c1
Sequence:CCGGGAGATGTTTGTTGGCTCAGATCTCGAGATCTGAGCCAACAAACATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152442.2-2143s1c1
Sequence:CCGGGCCTGGCTAATTTCTGGTATTCTCGAGAATACCAGAAATTAGCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152442.2-2453s1c1
Sequence:CCGGGCCTGAGTTTGGAGTGGAATACTCGAGTATTCCACTCCAAACTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152442
RAD9B MISSION shRNA Lentiviral Transduction Particles
RAD9 homolog B (S. pombe)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152442.2-733s1c1
Sequence:CCGGCTTGCTGTTACTCCACTGAATCTCGAGATTCAGTGGAGTAACAGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152442.2-799s1c1
Sequence:CCGGGCTGTACACAGTGAGATGTTTCTCGAGAAACATCTCACTGTGTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152442.2-854s1c1
Sequence:CCGGGAATGGACACTGAGATAACATCTCGAGATGTTATCTCAGTGTCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152442.2-1798s1c1
Sequence:CCGGGCCATCAAGATGGCTTGAAATCTCGAGATTTCAAGCCATCTTGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152442.2-1012s1c1
Sequence:CCGGGCCACATTAGCTGATGAACAACTCGAGTTGTTCATCAGCTAATGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152442.2-1325s1c1
Sequence:CCGGGCATGTTCTTTGGAGCAGTTTCTCGAGAAACTGCTCCAAAGAACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152442.2-811s1c1
Sequence:CCGGGAGATGTTTGTTGGCTCAGATCTCGAGATCTGAGCCAACAAACATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152442.2-2143s1c1
Sequence:CCGGGCCTGGCTAATTTCTGGTATTCTCGAGAATACCAGAAATTAGCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152442.2-2453s1c1
Sequence:CCGGGCCTGAGTTTGGAGTGGAATACTCGAGTATTCCACTCCAAACTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144912
RAD9B MISSION shRNA Bacterial Glycerol Stock
RAD9 homolog B (S. pombe)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144912.1-1322s1c1
Sequence:CCGGCCAGACTATCAGTGTCACTAACTCGAGTTAGTGACACTGATAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144912.1-829s1c1
Sequence:CCGGCGTTAGTGGATTATCCGAGTACTCGAGTACTCGGATAATCCACTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144912.1-1129s1c1
Sequence:CCGGGCATGTTCTTTGGAGCTGTATCTCGAGATACAGCTCCAAAGAACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144912.1-639s1c1
Sequence:CCGGCCGGAAGAGTTTGACTTCTTTCTCGAGAAAGAAGTCAAACTCTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144912.1-508s1c1
Sequence:CCGGCCATTGCTCTTCTGACATCAACTCGAGTTGATGTCAGAAGAGCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144912
RAD9B MISSION shRNA shRNA Plasmid DNA
RAD9 homolog B (S. pombe)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144912.1-1322s1c1
Sequence:CCGGCCAGACTATCAGTGTCACTAACTCGAGTTAGTGACACTGATAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144912.1-829s1c1
Sequence:CCGGCGTTAGTGGATTATCCGAGTACTCGAGTACTCGGATAATCCACTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144912.1-1129s1c1
Sequence:CCGGGCATGTTCTTTGGAGCTGTATCTCGAGATACAGCTCCAAAGAACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144912.1-639s1c1
Sequence:CCGGCCGGAAGAGTTTGACTTCTTTCTCGAGAAAGAAGTCAAACTCTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144912.1-508s1c1
Sequence:CCGGCCATTGCTCTTCTGACATCAACTCGAGTTGATGTCAGAAGAGCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144912
RAD9B MISSION shRNA Lentiviral Transduction Particles
RAD9 homolog B (S. pombe)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144912.1-1322s1c1
Sequence:CCGGCCAGACTATCAGTGTCACTAACTCGAGTTAGTGACACTGATAGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144912.1-829s1c1
Sequence:CCGGCGTTAGTGGATTATCCGAGTACTCGAGTACTCGGATAATCCACTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144912.1-1129s1c1
Sequence:CCGGGCATGTTCTTTGGAGCTGTATCTCGAGATACAGCTCCAAAGAACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144912.1-639s1c1
Sequence:CCGGCCGGAAGAGTTTGACTTCTTTCTCGAGAAAGAAGTCAAACTCTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144912.1-508s1c1
Sequence:CCGGCCATTGCTCTTCTGACATCAACTCGAGTTGATGTCAGAAGAGCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)