EMAIL THIS PAGE TO A FRIEND

RADIL

Ras association and DIL domains

54 Gene Product Result for
Synonyms: RASIP2
Gene ID:
Mouse(231858) Ras association and DIL domains
Rat(304299) Ras association and DIL domains
Zebrafish(562363) Rap GTPase interactor
chicken(416479) Ras association and DIL domains
domestic cat(101094810) Ras association and DIL domains
dog(479761) Ras association and DIL domains
domestic guinea pig(100723730) Ras association and DIL domains
naked mole-rat(101724144) Ras association and DIL domains
cow(506708) Ras association and DIL domains
sheep(101109764) Ras association and DIL domains
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178702 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178702 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178702 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018059 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018059 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018059 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018059 Rosetta Predictions human pricing
NM_001037218 Rosetta Predictions rat pricing
NM_178702 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212091 predicted 1746
2 SASI_Hs01_00212092 predicted 1706
3 SASI_Hs01_00212093 predicted 1136
4 SASI_Hs01_00212094 predicted 1863
5 SASI_Hs01_00212095 predicted 3288
6 SASI_Hs02_00351195 predicted 630
7 SASI_Hs01_00212096 predicted 2861
8 SASI_Hs02_00351196 predicted 2240
9 SASI_Hs01_00212097 predicted 1671
10 SASI_Hs01_00212099 predicted 1874
11 SASI_Hs01_00212098 predicted 3179
12 SASI_Hs01_00212100 predicted 2570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037218 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073996 predicted 370
2 SASI_Rn02_00204341 predicted 1860
3 SASI_Rn01_00073998 predicted 576
4 SASI_Rn01_00073999 predicted 3290
5 SASI_Rn01_00074000 predicted 226
6 SASI_Rn01_00074001 predicted 481
7 SASI_Rn01_00074002 predicted 3146
8 SASI_Rn01_00074003 predicted 1132
9 SASI_Rn01_00074004 predicted 1678
10 SASI_Rn01_00074005 predicted 1579
11 SASI_Rn01_00073997 predicted 1788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056136 predicted 580
2 SASI_Mm01_00056137 predicted 3108
3 SASI_Mm01_00056138 predicted 2709
4 SASI_Mm01_00056139 predicted 2980
5 SASI_Mm01_00056140 predicted 228
6 SASI_Mm01_00056141 predicted 1159
7 SASI_Mm01_00056142 predicted 1861
8 SASI_Mm02_00349203 predicted 1851
9 SASI_Mm01_00056144 predicted 2647
10 SASI_Mm01_00056145 predicted 2482
11 SASI_Mm01_00056143 predicted 2544
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178702
RADIL MISSION shRNA Bacterial Glycerol Stock
Ras association and DIL domains
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178702.2-3028s1c1
Sequence:CCGGGAAGGAGATGCGATTCAGGATCTCGAGATCCTGAATCGCATCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178702.2-426s1c1
Sequence:CCGGCACCCACTATAAGAGTGTCTTCTCGAGAAGACACTCTTATAGTGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178702.3-3526s21c1
Sequence:CCGGCTCACGTTGAGGACACCTTTGCTCGAGCAAAGGTGTCCTCAACGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178702.3-251s21c1
Sequence:CCGGGGACACTGAGCTACAAGTATCCTCGAGGATACTTGTAGCTCAGTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178702.3-379s21c1
Sequence:CCGGTGTACAGGCACCCACTATAAGCTCGAGCTTATAGTGGGTGCCTGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178702.3-1856s21c1
Sequence:CCGGCTTTCCAGCAGTGCGTGTATTCTCGAGAATACACGCACTGCTGGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178702.3-554s21c1
Sequence:CCGGTCCGAGTATTTGGCGACAATGCTCGAGCATTGTCGCCAAATACTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178702
RADIL MISSION shRNA shRNA Plasmid DNA
Ras association and DIL domains
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178702.2-3028s1c1
Sequence:CCGGGAAGGAGATGCGATTCAGGATCTCGAGATCCTGAATCGCATCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178702.2-426s1c1
Sequence:CCGGCACCCACTATAAGAGTGTCTTCTCGAGAAGACACTCTTATAGTGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178702.3-3526s21c1
Sequence:CCGGCTCACGTTGAGGACACCTTTGCTCGAGCAAAGGTGTCCTCAACGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178702.3-251s21c1
Sequence:CCGGGGACACTGAGCTACAAGTATCCTCGAGGATACTTGTAGCTCAGTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178702.3-379s21c1
Sequence:CCGGTGTACAGGCACCCACTATAAGCTCGAGCTTATAGTGGGTGCCTGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178702.3-1856s21c1
Sequence:CCGGCTTTCCAGCAGTGCGTGTATTCTCGAGAATACACGCACTGCTGGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178702.3-554s21c1
Sequence:CCGGTCCGAGTATTTGGCGACAATGCTCGAGCATTGTCGCCAAATACTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178702
RADIL MISSION shRNA Lentiviral Transduction Particles
Ras association and DIL domains
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178702.2-3028s1c1
Sequence:CCGGGAAGGAGATGCGATTCAGGATCTCGAGATCCTGAATCGCATCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178702.2-426s1c1
Sequence:CCGGCACCCACTATAAGAGTGTCTTCTCGAGAAGACACTCTTATAGTGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178702.3-3526s21c1
Sequence:CCGGCTCACGTTGAGGACACCTTTGCTCGAGCAAAGGTGTCCTCAACGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178702.3-251s21c1
Sequence:CCGGGGACACTGAGCTACAAGTATCCTCGAGGATACTTGTAGCTCAGTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178702.3-379s21c1
Sequence:CCGGTGTACAGGCACCCACTATAAGCTCGAGCTTATAGTGGGTGCCTGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178702.3-1856s21c1
Sequence:CCGGCTTTCCAGCAGTGCGTGTATTCTCGAGAATACACGCACTGCTGGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178702.3-554s21c1
Sequence:CCGGTCCGAGTATTTGGCGACAATGCTCGAGCATTGTCGCCAAATACTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018059
RADIL MISSION shRNA Bacterial Glycerol Stock
Ras association and DIL domains
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018059.2-3311s1c1
Sequence:CCGGCCAAGAAGATCCATTTCCGCACTCGAGTGCGGAAATGGATCTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018059.2-3300s1c1
Sequence:CCGGCGTGGAAACAGCCAAGAAGATCTCGAGATCTTCTTGGCTGTTTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018059.2-5018s1c1
Sequence:CCGGCCTGGCCTTGTTCTGTTTCTTCTCGAGAAGAAACAGAACAAGGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018059.2-4884s1c1
Sequence:CCGGCGCTTGGCTAATTTAGTACTTCTCGAGAAGTACTAAATTAGCCAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018059.2-1666s1c1
Sequence:CCGGCTGTACTTTATCCAGCAGAAACTCGAGTTTCTGCTGGATAAAGTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018059.2-1371s1c1
Sequence:CCGGGCAGAGGATCATGACGTTGATCTCGAGATCAACGTCATGATCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018059.2-1826s1c1
Sequence:CCGGGCGTCTACTATGTCTCCAAGTCTCGAGACTTGGAGACATAGTAGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018059.2-574s1c1
Sequence:CCGGGAAGGTTTATCCCGGAGGTTTCTCGAGAAACCTCCGGGATAAACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018059.2-2410s1c1
Sequence:CCGGGATGTTCTGGAGTCCTACGAACTCGAGTTCGTAGGACTCCAGAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018059
RADIL MISSION shRNA shRNA Plasmid DNA
Ras association and DIL domains
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018059.2-3311s1c1
Sequence:CCGGCCAAGAAGATCCATTTCCGCACTCGAGTGCGGAAATGGATCTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018059.2-3300s1c1
Sequence:CCGGCGTGGAAACAGCCAAGAAGATCTCGAGATCTTCTTGGCTGTTTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018059.2-5018s1c1
Sequence:CCGGCCTGGCCTTGTTCTGTTTCTTCTCGAGAAGAAACAGAACAAGGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018059.2-4884s1c1
Sequence:CCGGCGCTTGGCTAATTTAGTACTTCTCGAGAAGTACTAAATTAGCCAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018059.2-1666s1c1
Sequence:CCGGCTGTACTTTATCCAGCAGAAACTCGAGTTTCTGCTGGATAAAGTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018059.2-1371s1c1
Sequence:CCGGGCAGAGGATCATGACGTTGATCTCGAGATCAACGTCATGATCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018059.2-1826s1c1
Sequence:CCGGGCGTCTACTATGTCTCCAAGTCTCGAGACTTGGAGACATAGTAGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018059.2-574s1c1
Sequence:CCGGGAAGGTTTATCCCGGAGGTTTCTCGAGAAACCTCCGGGATAAACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018059.2-2410s1c1
Sequence:CCGGGATGTTCTGGAGTCCTACGAACTCGAGTTCGTAGGACTCCAGAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018059
RADIL MISSION shRNA Lentiviral Transduction Particles
Ras association and DIL domains
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018059.2-3311s1c1
Sequence:CCGGCCAAGAAGATCCATTTCCGCACTCGAGTGCGGAAATGGATCTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018059.2-3300s1c1
Sequence:CCGGCGTGGAAACAGCCAAGAAGATCTCGAGATCTTCTTGGCTGTTTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018059.2-5018s1c1
Sequence:CCGGCCTGGCCTTGTTCTGTTTCTTCTCGAGAAGAAACAGAACAAGGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018059.2-4884s1c1
Sequence:CCGGCGCTTGGCTAATTTAGTACTTCTCGAGAAGTACTAAATTAGCCAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018059.2-1666s1c1
Sequence:CCGGCTGTACTTTATCCAGCAGAAACTCGAGTTTCTGCTGGATAAAGTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018059.2-1371s1c1
Sequence:CCGGGCAGAGGATCATGACGTTGATCTCGAGATCAACGTCATGATCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018059.2-1826s1c1
Sequence:CCGGGCGTCTACTATGTCTCCAAGTCTCGAGACTTGGAGACATAGTAGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018059.2-574s1c1
Sequence:CCGGGAAGGTTTATCCCGGAGGTTTCTCGAGAAACCTCCGGGATAAACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018059.2-2410s1c1
Sequence:CCGGGATGTTCTGGAGTCCTACGAACTCGAGTTCGTAGGACTCCAGAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)