EMAIL THIS PAGE TO A FRIEND

RAE1

ribonucleic acid export 1

66 Gene Product Result for
Synonyms: MIG14 MRNP41 Mnrp41 dJ481F12.3 dJ800J21.1
Gene ID:
Human(8480) Summary: Mutations in the Schizosaccharomyces pombe Rae1 and Saccharomyces cerevisiae Gle2 genes have been shown to result in accumulation of poly(A)-containing mRNA in the nucleus, suggesting that the encoded proteins are involved in RNA export. The protein encoded by this gene is a homolog of yeast Rae1. It contains four WD40 motifs, and has been shown to localize to distinct foci in the nucleoplasm, to the nuclear rim, and to meshwork-like structures throughout the cytoplasm. This gene is thought to be involved in nucleocytoplasmic transport, and in directly or indirectly attaching cytoplasmic mRNPs to the cytoskeleton. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(66679) RAE1 RNA export 1 homolog (S. pombe)
Rat(362281) RAE1 RNA export 1 homolog (S. pombe)
fruit fly(37467) CG9862 gene product from transcript CG9862-RA
domestic cat(101089760) RAE1 RNA export 1 homolog (S. pombe)
dog(485942) RAE1 RNA export 1 homolog (S. pombe)
Zebrafish(393973) RAE1 RNA export 1 homolog (S. pombe)
chicken(419324) RAE1 RNA export 1 homolog (S. pombe)
cow(513080) RAE1 RNA export 1 homolog (S. pombe)
sheep(101117864) RAE1 RNA export 1 homolog (S. pombe)
naked mole-rat(101707168) RAE1 RNA export 1 homolog (S. pombe)
Domestic Rabbit(100359017) RAE1 RNA export 1 homolog (S. pombe)
domestic guinea pig(100724811) RAE1 RNA export 1 homolog (S. pombe)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175112 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175112 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175112 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003610 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015885 Rosetta Predictions human pricing
NM_003610 Rosetta Predictions human pricing
NM_001033708 Rosetta Predictions rat pricing
NM_175112 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152109 predicted 1140
2 SASI_Hs01_00152110 predicted 1033
3 SASI_Hs02_00306672 predicted 723
4 SASI_Hs01_00152111 predicted 882
5 SASI_Hs02_00306673 predicted 973
6 SASI_Hs01_00152112 predicted 937
7 SASI_Hs01_00152113 predicted 962
8 SASI_Hs01_00152114 predicted 1070
9 SASI_Hs01_00152115 predicted 1187
10 SASI_Hs01_00152116 predicted 1121
11 SASI_Hs01_00152117 predicted 1088
12 SASI_Hs01_00152118 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171190 predicted 1118
2 SASI_Hs01_00171191 predicted 1011
3 SASI_Hs02_00335945 predicted 700
4 SASI_Hs01_00171192 predicted 850
5 SASI_Hs02_00335946 predicted 952
6 SASI_Hs01_00171193 predicted 913
7 SASI_Hs01_00171194 predicted 942
8 SASI_Hs01_00171195 predicted 1048
9 SASI_Hs01_00171196 predicted 1159
10 SASI_Hs01_00171197 predicted 1089
11 SASI_Hs01_00171198 predicted 1060
12 SASI_Hs01_00171199 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033708 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043544 predicted 1001
2 SASI_Rn01_00043546 predicted 772
3 SASI_Rn01_00043547 predicted 899
4 SASI_Rn01_00043548 predicted 496
5 SASI_Rn01_00043549 predicted 1067
6 SASI_Rn02_00203748 predicted 843
7 SASI_Rn01_00043550 predicted 618
8 SASI_Rn01_00043551 predicted 926
9 SASI_Rn01_00043552 predicted 251
10 SASI_Rn01_00043553 predicted 519
11 SASI_Rn01_00043545 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175112 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154154 predicted 682
2 SASI_Mm02_00345718 predicted 986
3 SASI_Mm01_00154158 predicted 721
4 SASI_Mm01_00154159 predicted 637
5 SASI_Mm01_00154160 predicted 979
6 SASI_Mm01_00154161 predicted 909
7 SASI_Mm01_00154162 predicted 369
8 SASI_Mm01_00154163 predicted 752
9 SASI_Mm02_00345719 predicted 1157
10 SASI_Mm02_00345720 predicted 1031
11 SASI_Mm01_00154155 predicted 1373
12 SASI_Mm01_00154156 predicted 572
13 SASI_Mm01_00154157 predicted 318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175112
VALIDATED
RAE1 MISSION shRNA Bacterial Glycerol Stock
ribonucleic acid export 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175112.4-746s21c1
Sequence:CCGGGCAACTCCCTGAACGCTGTTACTCGAGTAACAGCGTTCAGGGAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175112.4-1216s21c1
Sequence:CCGGATCACAATGGAAACATATTTGCTCGAGCAAATATGTTTCCATTGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175112.4-1363s21c1
Sequence:CCGGCTGGGACTGTTGGAGTTTCATCTCGAGATGAAACTCCAACAGTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175112.4-320s21c1
Sequence:CCGGCCACAATCCAATGAAGGATATCTCGAGATATCCTTCATTGGATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175112.4-719s21c1
Sequence:CCGGGCGGTCCTCAAATCCTATGATCTCGAGATCATAGGATTTGAGGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175112.2-321s1c1
Sequence:CCGGCCACAATCCAATGAAGGATATCTCGAGATATCCTTCATTGGATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175112.2-1364s1c1
Sequence:CCGGCTGGGACTGTTGGAGTTTCATCTCGAGATGAAACTCCAACAGTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175112.2-720s1c1
Sequence:CCGGGCGGTCCTCAAATCCTATGATCTCGAGATCATAGGATTTGAGGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175112.2-972s1c1
Sequence:CCGGTCACTACATCAACCCTCCAAACTCGAGTTTGGAGGGTTGATGTAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175112.2-628s1c1
Sequence:CCGGGCTCCTGTTAAGACCATACATCTCGAGATGTATGGTCTTAACAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175112
VALIDATED
RAE1 MISSION shRNA shRNA Plasmid DNA
ribonucleic acid export 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175112.4-746s21c1
Sequence:CCGGGCAACTCCCTGAACGCTGTTACTCGAGTAACAGCGTTCAGGGAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175112.4-1216s21c1
Sequence:CCGGATCACAATGGAAACATATTTGCTCGAGCAAATATGTTTCCATTGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175112.4-1363s21c1
Sequence:CCGGCTGGGACTGTTGGAGTTTCATCTCGAGATGAAACTCCAACAGTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175112.4-320s21c1
Sequence:CCGGCCACAATCCAATGAAGGATATCTCGAGATATCCTTCATTGGATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175112.4-719s21c1
Sequence:CCGGGCGGTCCTCAAATCCTATGATCTCGAGATCATAGGATTTGAGGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175112.2-321s1c1
Sequence:CCGGCCACAATCCAATGAAGGATATCTCGAGATATCCTTCATTGGATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175112.2-1364s1c1
Sequence:CCGGCTGGGACTGTTGGAGTTTCATCTCGAGATGAAACTCCAACAGTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175112.2-720s1c1
Sequence:CCGGGCGGTCCTCAAATCCTATGATCTCGAGATCATAGGATTTGAGGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175112.2-972s1c1
Sequence:CCGGTCACTACATCAACCCTCCAAACTCGAGTTTGGAGGGTTGATGTAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175112.2-628s1c1
Sequence:CCGGGCTCCTGTTAAGACCATACATCTCGAGATGTATGGTCTTAACAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175112
VALIDATED
RAE1 MISSION shRNA Lentiviral Transduction Particles
ribonucleic acid export 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175112.4-746s21c1
Sequence:CCGGGCAACTCCCTGAACGCTGTTACTCGAGTAACAGCGTTCAGGGAGTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175112.4-1216s21c1
Sequence:CCGGATCACAATGGAAACATATTTGCTCGAGCAAATATGTTTCCATTGTGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000323565    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175112.4-1363s21c1
Sequence:CCGGCTGGGACTGTTGGAGTTTCATCTCGAGATGAAACTCCAACAGTCCCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000323634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175112.4-320s21c1
Sequence:CCGGCCACAATCCAATGAAGGATATCTCGAGATATCCTTCATTGGATTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000323636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175112.4-719s21c1
Sequence:CCGGGCGGTCCTCAAATCCTATGATCTCGAGATCATAGGATTTGAGGACCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175112.2-321s1c1
Sequence:CCGGCCACAATCCAATGAAGGATATCTCGAGATATCCTTCATTGGATTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175112.2-1364s1c1
Sequence:CCGGCTGGGACTGTTGGAGTTTCATCTCGAGATGAAACTCCAACAGTCCCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175112.2-720s1c1
Sequence:CCGGGCGGTCCTCAAATCCTATGATCTCGAGATCATAGGATTTGAGGACCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175112.2-972s1c1
Sequence:CCGGTCACTACATCAACCCTCCAAACTCGAGTTTGGAGGGTTGATGTAGTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175112.2-628s1c1
Sequence:CCGGGCTCCTGTTAAGACCATACATCTCGAGATGTATGGTCTTAACAGGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003610
VALIDATED
RAE1 MISSION shRNA Bacterial Glycerol Stock
ribonucleic acid export 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003610.3-1299s21c1
Sequence:CCGGGCTTGCTGTTTCAATCACAATCTCGAGATTGTGATTGAAACAGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003610.3-740s1c1
Sequence:CCGGCCATTGGATCAAAGCTCCAAACTCGAGTTTGGAGCTTTGATCCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003610.3-1149s1c1
Sequence:CCGGCCTCAGGACATTTATGCGGTACTCGAGTACCGCATAAATGTCCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003610.3-1470s1c1
Sequence:CCGGCCAGAGTTGTTTCTCTCCACTCTCGAGAGTGGAGAGAAACAACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003610.3-1572s1c1
Sequence:CCGGCGATGTCATTGTTCAGCAGCTCTCGAGAGCTGCTGAACAATGACATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003610.3-1572s21c1
Sequence:CCGGCGATGTCATTGTTCAGCAGCTCTCGAGAGCTGCTGAACAATGACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003610.3-1470s21c1
Sequence:CCGGCCAGAGTTGTTTCTCTCCACTCTCGAGAGTGGAGAGAAACAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003610.3-1321s1c1
Sequence:CCGGGAAACATATTTGCATACGCTTCTCGAGAAGCGTATGCAAATATGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003610.3-956s1c1
Sequence:CCGGGAGGATAGAATCTCCACTGAACTCGAGTTCAGTGGAGATTCTATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003610.3-807s21c1
Sequence:CCGGTGGGATACTCGATCGTCAAATCTCGAGATTTGACGATCGAGTATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003610.3-1299s1c1
Sequence:CCGGGCTTGCTGTTTCAATCACAATCTCGAGATTGTGATTGAAACAGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003610
VALIDATED
RAE1 MISSION shRNA shRNA Plasmid DNA
ribonucleic acid export 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003610.3-1299s21c1
Sequence:CCGGGCTTGCTGTTTCAATCACAATCTCGAGATTGTGATTGAAACAGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003610.3-740s1c1
Sequence:CCGGCCATTGGATCAAAGCTCCAAACTCGAGTTTGGAGCTTTGATCCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003610.3-1149s1c1
Sequence:CCGGCCTCAGGACATTTATGCGGTACTCGAGTACCGCATAAATGTCCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003610.3-1470s1c1
Sequence:CCGGCCAGAGTTGTTTCTCTCCACTCTCGAGAGTGGAGAGAAACAACTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003610.3-1572s1c1
Sequence:CCGGCGATGTCATTGTTCAGCAGCTCTCGAGAGCTGCTGAACAATGACATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003610.3-1572s21c1
Sequence:CCGGCGATGTCATTGTTCAGCAGCTCTCGAGAGCTGCTGAACAATGACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003610.3-1470s21c1
Sequence:CCGGCCAGAGTTGTTTCTCTCCACTCTCGAGAGTGGAGAGAAACAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003610.3-1321s1c1
Sequence:CCGGGAAACATATTTGCATACGCTTCTCGAGAAGCGTATGCAAATATGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003610.3-956s1c1
Sequence:CCGGGAGGATAGAATCTCCACTGAACTCGAGTTCAGTGGAGATTCTATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003610.3-807s21c1
Sequence:CCGGTGGGATACTCGATCGTCAAATCTCGAGATTTGACGATCGAGTATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003610.3-1299s1c1
Sequence:CCGGGCTTGCTGTTTCAATCACAATCTCGAGATTGTGATTGAAACAGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003610
VALIDATED
RAE1 MISSION shRNA Lentiviral Transduction Particles
ribonucleic acid export 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003610.3-1299s21c1
Sequence:CCGGGCTTGCTGTTTCAATCACAATCTCGAGATTGTGATTGAAACAGCAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003610.3-740s1c1
Sequence:CCGGCCATTGGATCAAAGCTCCAAACTCGAGTTTGGAGCTTTGATCCAATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000164681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003610.3-1149s1c1
Sequence:CCGGCCTCAGGACATTTATGCGGTACTCGAGTACCGCATAAATGTCCTGAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000165752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003610.3-1470s1c1
Sequence:CCGGCCAGAGTTGTTTCTCTCCACTCTCGAGAGTGGAGAGAAACAACTCTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000166724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003610.3-1572s1c1
Sequence:CCGGCGATGTCATTGTTCAGCAGCTCTCGAGAGCTGCTGAACAATGACATCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000279669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_003610.3-1572s21c1
Sequence:CCGGCGATGTCATTGTTCAGCAGCTCTCGAGAGCTGCTGAACAATGACATCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000279721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003610.3-1470s21c1
Sequence:CCGGCCAGAGTTGTTTCTCTCCACTCTCGAGAGTGGAGAGAAACAACTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000158987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003610.3-1321s1c1
Sequence:CCGGGAAACATATTTGCATACGCTTCTCGAGAAGCGTATGCAAATATGTTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000160979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003610.3-956s1c1
Sequence:CCGGGAGGATAGAATCTCCACTGAACTCGAGTTCAGTGGAGATTCTATCCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000337192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003610.3-807s21c1
Sequence:CCGGTGGGATACTCGATCGTCAAATCTCGAGATTTGACGATCGAGTATCCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000158931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003610.3-1299s1c1
Sequence:CCGGGCTTGCTGTTTCAATCACAATCTCGAGATTGTGATTGAAACAGCAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???