EMAIL THIS PAGE TO A FRIEND

RAET1G

retinoic acid early transcript 1G

11 Gene Product Result for
Synonyms: ULBP5
UniProtKB ID: Q6H3X3, Q6H3X2
Gene ID:
Human(353091) Summary: Members of the RAET1 family, such as RAET1G, are major histocompatibility complex (MHC) class I-related genes located within a 180-kb cluster on chromosome 6q24.2-q25.3. RAET1 proteins contain MHC class I-like alpha-1 and alpha-2 domains. RAET1E (MIM 609243) and RAET1G differ from the other RAET1 proteins (e.g., RAET1I, or ULBP1; MIM 605697) in that they have type I membrane-spanning sequences at their C termini rather than glycosylphosphatidylinositol anchor sequences. (Radosavljevic et al., 2002 [PubMed 11827464]
cow(404100) retinoic acid early transcript 1G
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1411732 Anti-RAET1G antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001788 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001788 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001788 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001788 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213614 predicted 459
2 SASI_Hs02_00303931 predicted 785
3 SASI_Hs02_00303932 predicted 766
4 SASI_Hs01_00213616 predicted 861
5 SASI_Hs01_00213615 predicted 798
6 SASI_Hs01_00213617 predicted 92
7 SASI_Hs01_00213613 predicted 416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001788
RAET1G MISSION shRNA Bacterial Glycerol Stock
retinoic acid early transcript 1G
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001788.2-771s21c1
Sequence:CCGGCTCATCATGTGTCTCCTCATACTCGAGTATGAGGAGACACATGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001788.2-908s21c1
Sequence:CCGGCAGCTACCAAATAGCGAAGCGCTCGAGCGCTTCGCTATTTGGTAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001788.2-933s21c1
Sequence:CCGGTTGTCTGGTGGACACGTGACTCTCGAGAGTCACGTGTCCACCAGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001788.2-881s21c1
Sequence:CCGGGCTGCTGAGAAGAGTCCTTTGCTCGAGCAAAGGACTCTTCTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-331s1c1
Sequence:CCGGGAGAATTACATACCCAAGGAACTCGAGTTCCTTGGGTATGTAATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-85s1c1
Sequence:CCGGGACCCTCACTCTCTTTGCTATCTCGAGATAGCAAAGAGAGTGAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-529s1c1
Sequence:CCGGGATATGACCATGTCCTTCCATCTCGAGATGGAAGGACATGGTCATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-525s1c1
Sequence:CCGGCAAGGATATGACCATGTCCTTCTCGAGAAGGACATGGTCATATCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-729s1c1
Sequence:CCGGCTTTGGAGTGACAGCTACCAACTCGAGTTGGTAGCTGTCACTCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-782s1c1
Sequence:CCGGGACTCGCGTGACTTTACCTATCTCGAGATAGGTAAAGTCACGCGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-420s1c1
Sequence:CCGGGCTCAGTTTCGATGGACAGATCTCGAGATCTGTCCATCGAAACTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001788
RAET1G MISSION shRNA shRNA Plasmid DNA
retinoic acid early transcript 1G
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001788.2-771s21c1
Sequence:CCGGCTCATCATGTGTCTCCTCATACTCGAGTATGAGGAGACACATGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001788.2-908s21c1
Sequence:CCGGCAGCTACCAAATAGCGAAGCGCTCGAGCGCTTCGCTATTTGGTAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001788.2-933s21c1
Sequence:CCGGTTGTCTGGTGGACACGTGACTCTCGAGAGTCACGTGTCCACCAGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001788.2-881s21c1
Sequence:CCGGGCTGCTGAGAAGAGTCCTTTGCTCGAGCAAAGGACTCTTCTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-331s1c1
Sequence:CCGGGAGAATTACATACCCAAGGAACTCGAGTTCCTTGGGTATGTAATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-85s1c1
Sequence:CCGGGACCCTCACTCTCTTTGCTATCTCGAGATAGCAAAGAGAGTGAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-529s1c1
Sequence:CCGGGATATGACCATGTCCTTCCATCTCGAGATGGAAGGACATGGTCATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-525s1c1
Sequence:CCGGCAAGGATATGACCATGTCCTTCTCGAGAAGGACATGGTCATATCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-729s1c1
Sequence:CCGGCTTTGGAGTGACAGCTACCAACTCGAGTTGGTAGCTGTCACTCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-782s1c1
Sequence:CCGGGACTCGCGTGACTTTACCTATCTCGAGATAGGTAAAGTCACGCGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-420s1c1
Sequence:CCGGGCTCAGTTTCGATGGACAGATCTCGAGATCTGTCCATCGAAACTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001788
RAET1G MISSION shRNA Lentiviral Transduction Particles
retinoic acid early transcript 1G
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001788.2-771s21c1
Sequence:CCGGCTCATCATGTGTCTCCTCATACTCGAGTATGAGGAGACACATGATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001788.2-908s21c1
Sequence:CCGGCAGCTACCAAATAGCGAAGCGCTCGAGCGCTTCGCTATTTGGTAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001788.2-933s21c1
Sequence:CCGGTTGTCTGGTGGACACGTGACTCTCGAGAGTCACGTGTCCACCAGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001788.2-881s21c1
Sequence:CCGGGCTGCTGAGAAGAGTCCTTTGCTCGAGCAAAGGACTCTTCTCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-331s1c1
Sequence:CCGGGAGAATTACATACCCAAGGAACTCGAGTTCCTTGGGTATGTAATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-85s1c1
Sequence:CCGGGACCCTCACTCTCTTTGCTATCTCGAGATAGCAAAGAGAGTGAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-529s1c1
Sequence:CCGGGATATGACCATGTCCTTCCATCTCGAGATGGAAGGACATGGTCATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-525s1c1
Sequence:CCGGCAAGGATATGACCATGTCCTTCTCGAGAAGGACATGGTCATATCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-729s1c1
Sequence:CCGGCTTTGGAGTGACAGCTACCAACTCGAGTTGGTAGCTGTCACTCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-782s1c1
Sequence:CCGGGACTCGCGTGACTTTACCTATCTCGAGATAGGTAAAGTCACGCGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001788.1-420s1c1
Sequence:CCGGGCTCAGTTTCGATGGACAGATCTCGAGATCTGTCCATCGAAACTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)