EMAIL THIS PAGE TO A FRIEND

RAET1L

retinoic acid early transcript 1L

24 Gene Product Result for
Synonyms: ULBP6
UniProtKB ID: Q5VY80, A3KME4, Q8TE74
Gene ID:
Human(154064) Summary: RAET1L belongs to the RAET1 family of major histocompatibility complex (MHC) class I-related genes, which are located within a 180-kb cluster on chromosome 6q24.2-q25.3. The REAT1 genes encode glycoproteins that contain extracellular alpha-1 and alpha-2 domains, but they lack the membrane proximal Ig-like alpha-3 domain. Most RAET1 glycoproteins are anchored to the membrane via glycosylphosphatidylinositol (GPI) linkage (Radosavljevic et al., 2002 [PubMed 11827464]
Rat(292461) retinoic acid early transcript 1L
cow(785375) retinoic acid early transcript 1L
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130900 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130900 Rosetta Predictions human pricing
NM_001013063 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193707 predicted 487
2 SASI_Hs01_00193708 predicted 446
3 SASI_Hs01_00193709 predicted 453
4 SASI_Hs01_00193710 predicted 405
5 SASI_Hs01_00193711 predicted 442
6 SASI_Hs01_00193712 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013063 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069730 predicted 562
2 SASI_Rn01_00069731 predicted 1190
3 SASI_Rn02_00200682 predicted 466
4 SASI_Rn02_00200683 predicted 749
5 SASI_Rn01_00069723 predicted 349
6 SASI_Rn01_00069724 predicted 858
7 SASI_Rn01_00069725 predicted 276
8 SASI_Rn01_00069726 predicted 657
9 SASI_Rn01_00069727 predicted 651
10 SASI_Rn01_00069728 predicted 215
11 SASI_Rn01_00069729 predicted 355
12 SASI_Rn01_00069732 predicted 913
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130900
RAET1L MISSION shRNA Bacterial Glycerol Stock
retinoic acid early transcript 1L
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-557s1c1
Sequence:CCGGCAATGGGAGACTGCATAGGATCTCGAGATCCTATGCAGTCTCCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-315s1c1
Sequence:CCGGGCTTGACATTCAGCTGGAGAACTCGAGTTCTCCAGCTGAATGTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-546s1c1
Sequence:CCGGCCATTACATCTCAATGGGAGACTCGAGTCTCCCATTGAGATGTAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-491s1c1
Sequence:CCGGGAGCCAGAAAGATGAAAGAAACTCGAGTTTCTTTCATCTTTCTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-458s1c1
Sequence:CCGGCAGAGAAGAGAATGTGGACAACTCGAGTTGTCCACATTCTCTTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-327s1c1
Sequence:CCGGGCTGGAGAATTACACACCCAACTCGAGTTGGGTGTGTAATTCTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130900.2-249s21c1
Sequence:CCGGACTATGACTGTGGCAACAAGACTCGAGTCTTGTTGCCACAGTCATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130900.2-495s21c1
Sequence:CCGGGACAGACCTTCCTACTCTTTGCTCGAGCAAAGAGTAGGAAGGTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130900.2-142s21c1
Sequence:CCGGAGACGACCCTCACTCTCTTTGCTCGAGCAAAGAGAGTGAGGGTCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130900.2-346s21c1
Sequence:CCGGAGAGGTGGTGGACATACTTACCTCGAGGTAAGTATGTCCACCACCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130900
RAET1L MISSION shRNA shRNA Plasmid DNA
retinoic acid early transcript 1L
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-557s1c1
Sequence:CCGGCAATGGGAGACTGCATAGGATCTCGAGATCCTATGCAGTCTCCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-315s1c1
Sequence:CCGGGCTTGACATTCAGCTGGAGAACTCGAGTTCTCCAGCTGAATGTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-546s1c1
Sequence:CCGGCCATTACATCTCAATGGGAGACTCGAGTCTCCCATTGAGATGTAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-491s1c1
Sequence:CCGGGAGCCAGAAAGATGAAAGAAACTCGAGTTTCTTTCATCTTTCTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-458s1c1
Sequence:CCGGCAGAGAAGAGAATGTGGACAACTCGAGTTGTCCACATTCTCTTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-327s1c1
Sequence:CCGGGCTGGAGAATTACACACCCAACTCGAGTTGGGTGTGTAATTCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130900.2-249s21c1
Sequence:CCGGACTATGACTGTGGCAACAAGACTCGAGTCTTGTTGCCACAGTCATAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130900.2-495s21c1
Sequence:CCGGGACAGACCTTCCTACTCTTTGCTCGAGCAAAGAGTAGGAAGGTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130900.2-142s21c1
Sequence:CCGGAGACGACCCTCACTCTCTTTGCTCGAGCAAAGAGAGTGAGGGTCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130900.2-346s21c1
Sequence:CCGGAGAGGTGGTGGACATACTTACCTCGAGGTAAGTATGTCCACCACCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130900
RAET1L MISSION shRNA Lentiviral Transduction Particles
retinoic acid early transcript 1L
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-557s1c1
Sequence:CCGGCAATGGGAGACTGCATAGGATCTCGAGATCCTATGCAGTCTCCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-315s1c1
Sequence:CCGGGCTTGACATTCAGCTGGAGAACTCGAGTTCTCCAGCTGAATGTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-546s1c1
Sequence:CCGGCCATTACATCTCAATGGGAGACTCGAGTCTCCCATTGAGATGTAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-491s1c1
Sequence:CCGGGAGCCAGAAAGATGAAAGAAACTCGAGTTTCTTTCATCTTTCTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-458s1c1
Sequence:CCGGCAGAGAAGAGAATGTGGACAACTCGAGTTGTCCACATTCTCTTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_130900.1-327s1c1
Sequence:CCGGGCTGGAGAATTACACACCCAACTCGAGTTGGGTGTGTAATTCTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130900.2-249s21c1
Sequence:CCGGACTATGACTGTGGCAACAAGACTCGAGTCTTGTTGCCACAGTCATAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130900.2-495s21c1
Sequence:CCGGGACAGACCTTCCTACTCTTTGCTCGAGCAAAGAGTAGGAAGGTCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130900.2-142s21c1
Sequence:CCGGAGACGACCCTCACTCTCTTTGCTCGAGCAAAGAGAGTGAGGGTCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130900.2-346s21c1
Sequence:CCGGAGAGGTGGTGGACATACTTACCTCGAGGTAAGTATGTCCACCACCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)