EMAIL THIS PAGE TO A FRIEND

RAF1

v-raf-1 murine leukemia viral oncogene homolog 1

125 Gene Product Result for
Synonyms: CRAF NS5 Raf-1 c-Raf
UniProtKB ID: P04049, B0LPH8, B2R5N3, Q15278, Q9UC20
Gene ID:
Human(5894) Summary: This gene is the cellular homolog of viral raf gene (v-raf). The encoded protein is a MAP kinase kinase kinase (MAP3K), which functions downstream of the Ras family of membrane associated GTPases to which it binds directly. Once activated, the cellular RAF1 protein can phosphorylate to activate the dual specificity protein kinases MEK1 and MEK2, which in turn phosphorylate to activate the serine/threonine specific protein kinases, ERK1 and ERK2. Activated ERKs are pleiotropic effectors of cell physiology and play an important role in the control of gene expression involved in the cell division cycle, apoptosis, cell differentiation and cell migration. Mutations in this gene are associated with Noonan syndrome 5 and LEOPARD syndrome 2. [provided by RefSeq, Jul 2008]
Mouse(110157) v-raf-leukemia viral oncogene 1
Rat(24703) v-raf-leukemia viral oncogene 1
cow(521196) v-raf-1 murine leukemia viral oncogene homolog 1
sheep(101103190) v-raf-1 murine leukemia viral oncogene homolog 1
domestic guinea pig(100720110) v-raf-1 murine leukemia viral oncogene homolog 1
Domestic Rabbit(100347407) v-raf-1 murine leukemia viral oncogene homolog 1
naked mole-rat(101721841) v-raf-1 murine leukemia viral oncogene homolog 1
chicken(396245) v-raf-1 murine leukemia viral oncogene homolog 1
dog(484648) v-raf-1 murine leukemia viral oncogene homolog 1
domestic cat(101096047) v-raf-1 murine leukemia viral oncogene homolog 1
Horse(100051110) v-raf-1 murine leukemia viral oncogene homolog 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502571 Anti-C-RAF antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4502573 Anti-C-RAF antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4502575 Anti-C-RAF antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4502576 Anti-C-RAF antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4502577 Anti-C-RAF antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
SAB4502578 Anti-C-RAF antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4502572 Anti-C-RAF, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502574 Anti-C-RAF, N-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504523 Anti-phospho-C-RAF (pSer259) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4504026 Anti-phospho-C-RAF (pSer296) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504524 Anti-phospho-C-RAF (pSer338) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
C7365 Anti-phospho-c-Raf (pSer338/pTyr340) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
western blot pricing
R1151 Anti-phospho-c-Raf (pSer621) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution, 10 blots human, mouse, rat
microarray, western blot pricing
SAB4503984 Anti-phospho-C-RAF (pSer621) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301520 Anti-phospho-C-RAF (pSer621) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4504759 Anti-phospho-C-RAF (pSer642) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4301241 Anti-phospho-C-RAF (pTyr341) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
05-538 Anti-phospho-Raf-1 (Ser338) Antibody clone, Upstate®, from mouse mouse
western blot pricing
05-534 Anti-phospho-Raf-1 (Ser338) Antibody clone, Upstate®, from rat mouse
western blot pricing
SAB4300005 Anti-phospho-RAF1 (pSer259) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4300164 Anti-phospho-RAF1 (pSer338) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB5700372 Anti-Phospho-RAF1-S259 antibody produced in rabbit New human, mouse
immunoprecipitation (IP), western blot pricing
SAB5700561 Anti-Phospho-RAF1-S296 antibody produced in rabbit New human
immunoprecipitation (IP), western blot pricing
SAB5700373 Anti-Phospho-RAF1-S338 antibody produced in rabbit New rat, mouse, human
western blot pricing
SAB5700322 Anti-Phospho-RAF1-S621 antibody produced in rabbit New human
immunofluorescence, immunoprecipitation (IP), western blot pricing
R5773 Anti-Raf-1 (631-648) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, human
immunoprecipitation (IP), microarray, western blot pricing
07-396 Anti-Raf-1 Antibody clone, Upstate®, from rabbit human
immunoprecipitation (IP), western blot pricing
SAB4300291 Anti-RAF1 (Ab-259) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4300462 Anti-RAF1 (Ab-338) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB1406366 Anti-RAF1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB4300639 Anti-Raf1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
HPA002640 Anti-RAF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB5700603 Anti-RAF1 antibody produced in rabbit New human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
15-107 MAPK Pathway 1 Explorer Antibody MiniPack clone AW39R, 1 mg/mL (05-538SP), Upstate® chicken, mouse (05-538SP), Xenopus, mouse, human (05-538SP), rat, human
activity assay, flow cytometry, immunofluorescence, multiplexing, western blot pricing
R2404 Monoclonal Anti-Raf-1/c-Raf antibody produced in mouse clone RNP1, purified from hybridoma cell culture mouse, rat, human
ELISA, immunocytochemistry, immunoprecipitation (IP), microarray, western blot pricing
SAB1413179 Monoclonal Anti-RAF1 (phospho S259) antibody produced in rabbit clone IOH-18 New human
immunohistochemistry, western blot pricing
SAB1413180 Monoclonal Anti-RAF1 (phospho S43) antibody produced in rabbit clone ICO-18 New human
western blot pricing
SAB1413181 Monoclonal Anti-RAF1 (phospho S621) antibody produced in rabbit clone IOF-18 New human
western blot pricing
SAB5300392 Monoclonal Anti-RAF1 antibody produced in mouse clone 4G4, purified immunoglobulin, buffered aqueous solution human
ELISA, flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029780 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029780 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029780 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002880 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002880 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002880 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002880 siRNAs that have been validated in the lab human pricing
NM_012639 Rosetta Predictions rat pricing
NM_029780 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002880 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174876 validated 721
1 SASI_Hs01_00174878 validated 935
2 SASI_Hs02_00334657 predicted 407
3 SASI_Hs01_00174877 predicted 1059
4 SASI_Hs01_00174879 predicted 2051
5 SASI_Hs01_00174880 predicted 891
6 SASI_Hs01_00174882 predicted 883
7 SASI_Hs01_00174883 predicted 952
8 SASI_Hs01_00174884 predicted 796
9 SASI_Hs01_00174885 predicted 395
10 SASI_Hs02_00334658 predicted 1505
11 SASI_Hs01_00174881 predicted 1709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085222 predicted 2313
2 SASI_Rn01_00085223 predicted 736
3 SASI_Rn01_00085224 predicted 1123
4 SASI_Rn01_00085226 predicted 2106
5 SASI_Rn02_00259875 predicted 966
6 SASI_Rn01_00085227 predicted 798
7 SASI_Rn01_00085228 predicted 1545
8 SASI_Rn02_00259876 predicted 428
9 SASI_Rn01_00085229 predicted 830
10 SASI_Rn01_00085230 predicted 297
11 SASI_Rn01_00085225 predicted 1134
12 SASI_Rn01_00085231 predicted 2251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186979 predicted 899
2 SASI_Mm01_00186980 predicted 436
3 SASI_Mm01_00186981 predicted 1245
4 SASI_Mm01_00186982 predicted 2121
5 SASI_Mm01_00186983 predicted 1098
6 SASI_Mm01_00186984 predicted 882
7 SASI_Mm01_00186985 predicted 924
8 SASI_Mm01_00186987 predicted 959
9 SASI_Mm01_00186988 predicted 816
10 SASI_Mm02_00335926 predicted 1015
11 SASI_Mm01_00186986 predicted 627
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029780
VALIDATED
RAF1 MISSION shRNA Bacterial Glycerol Stock
v-raf-1 murine leukemia viral oncogene homolog 1
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029780.3-1539s21c1
Sequence:CCGGTGTTGCAGTAAAGATCCTAAACTCGAGTTTAGGATCTTTACTGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029780.3-975s21c1
Sequence:CCGGGTGTGTGGACTGGAGTAATATCTCGAGATATTACTCCAGTCCACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029780.3-2756s21c1
Sequence:CCGGGCTTTGGTACTACAGAACTTTCTCGAGAAAGTTCTGTAGTACCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029780.3-1745s21c1
Sequence:CCGGTCCAGATGTTCCAGCTAATTGCTCGAGCAATTAGCTGGAACATCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-1126s1c1
Sequence:CCGGGCAGGATGATTGAGGATGCAACTCGAGTTGCATCCTCAATCATCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029780.1-2635s1c1
Sequence:CCGGGCTTTGGTACTACAGAACTTTCTCGAGAAAGTTCTGTAGTACCAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-1700s1c1
Sequence:CCGGCCACAGAGACATGAAATCCAACTCGAGTTGGATTTCATGTCTCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-522s1c1
Sequence:CCGGCGGAATGGAATGAGCTTACATCTCGAGATGTAAGCTCATTCCATTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-393s1c1
Sequence:CCGGCCTACCATTGTTCAGCAGTTTCTCGAGAAACTGCTGAACAATGGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029780.1-2781s1c1
Sequence:CCGGCAACCCTATCTGTAGCCACATCTCGAGATGTGGCTACAGATAGGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029780.1-466s1c1
Sequence:CCGGCAAGCAATACTATCCGGGTTTCTCGAGAAACCCGGATAGTATTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-1542s1c1
Sequence:CCGGACAAAGGACAACCTGGCGATTCTCGAGAATCGCCAGGTTGTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029780.1-2231s1c1
Sequence:CCGGCCCAAGGCTACCAGTCTTCTACTCGAGTAGAAGACTGGTAGCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-636s1c1
Sequence:CCGGCGCTTAGATTGGAACACCGATCTCGAGATCGGTGTTCCAATCTAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029780.3-587s21c1
Sequence:CCGGCAAGCAATACTATCCGGGTTTCTCGAGAAACCCGGATAGTATTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029780
VALIDATED
RAF1 MISSION shRNA shRNA Plasmid DNA
v-raf-1 murine leukemia viral oncogene homolog 1
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029780.3-1539s21c1
Sequence:CCGGTGTTGCAGTAAAGATCCTAAACTCGAGTTTAGGATCTTTACTGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029780.3-975s21c1
Sequence:CCGGGTGTGTGGACTGGAGTAATATCTCGAGATATTACTCCAGTCCACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029780.3-2756s21c1
Sequence:CCGGGCTTTGGTACTACAGAACTTTCTCGAGAAAGTTCTGTAGTACCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029780.3-1745s21c1
Sequence:CCGGTCCAGATGTTCCAGCTAATTGCTCGAGCAATTAGCTGGAACATCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-1126s1c1
Sequence:CCGGGCAGGATGATTGAGGATGCAACTCGAGTTGCATCCTCAATCATCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029780.1-2635s1c1
Sequence:CCGGGCTTTGGTACTACAGAACTTTCTCGAGAAAGTTCTGTAGTACCAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-1700s1c1
Sequence:CCGGCCACAGAGACATGAAATCCAACTCGAGTTGGATTTCATGTCTCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-522s1c1
Sequence:CCGGCGGAATGGAATGAGCTTACATCTCGAGATGTAAGCTCATTCCATTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-393s1c1
Sequence:CCGGCCTACCATTGTTCAGCAGTTTCTCGAGAAACTGCTGAACAATGGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029780.1-2781s1c1
Sequence:CCGGCAACCCTATCTGTAGCCACATCTCGAGATGTGGCTACAGATAGGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029780.1-466s1c1
Sequence:CCGGCAAGCAATACTATCCGGGTTTCTCGAGAAACCCGGATAGTATTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-1542s1c1
Sequence:CCGGACAAAGGACAACCTGGCGATTCTCGAGAATCGCCAGGTTGTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029780.1-2231s1c1
Sequence:CCGGCCCAAGGCTACCAGTCTTCTACTCGAGTAGAAGACTGGTAGCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-636s1c1
Sequence:CCGGCGCTTAGATTGGAACACCGATCTCGAGATCGGTGTTCCAATCTAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029780.3-587s21c1
Sequence:CCGGCAAGCAATACTATCCGGGTTTCTCGAGAAACCCGGATAGTATTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029780
VALIDATED
RAF1 MISSION shRNA Lentiviral Transduction Particles
v-raf-1 murine leukemia viral oncogene homolog 1
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029780.3-1539s21c1
Sequence:CCGGTGTTGCAGTAAAGATCCTAAACTCGAGTTTAGGATCTTTACTGCAACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000312751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029780.3-975s21c1
Sequence:CCGGGTGTGTGGACTGGAGTAATATCTCGAGATATTACTCCAGTCCACACACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000312820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029780.3-2756s21c1
Sequence:CCGGGCTTTGGTACTACAGAACTTTCTCGAGAAAGTTCTGTAGTACCAAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000312749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029780.3-1745s21c1
Sequence:CCGGTCCAGATGTTCCAGCTAATTGCTCGAGCAATTAGCTGGAACATCTGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-1126s1c1
Sequence:CCGGGCAGGATGATTGAGGATGCAACTCGAGTTGCATCCTCAATCATCCTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029780.1-2635s1c1
Sequence:CCGGGCTTTGGTACTACAGAACTTTCTCGAGAAAGTTCTGTAGTACCAAAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-1700s1c1
Sequence:CCGGCCACAGAGACATGAAATCCAACTCGAGTTGGATTTCATGTCTCTGTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-522s1c1
Sequence:CCGGCGGAATGGAATGAGCTTACATCTCGAGATGTAAGCTCATTCCATTCCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-393s1c1
Sequence:CCGGCCTACCATTGTTCAGCAGTTTCTCGAGAAACTGCTGAACAATGGTAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000055138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029780.1-2781s1c1
Sequence:CCGGCAACCCTATCTGTAGCCACATCTCGAGATGTGGCTACAGATAGGGTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000055140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029780.1-466s1c1
Sequence:CCGGCAAGCAATACTATCCGGGTTTCTCGAGAAACCCGGATAGTATTGCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000055141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-1542s1c1
Sequence:CCGGACAAAGGACAACCTGGCGATTCTCGAGAATCGCCAGGTTGTCCTTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000055142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029780.1-2231s1c1
Sequence:CCGGCCCAAGGCTACCAGTCTTCTACTCGAGTAGAAGACTGGTAGCCTTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000055139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029780.1-636s1c1
Sequence:CCGGCGCTTAGATTGGAACACCGATCTCGAGATCGGTGTTCCAATCTAAGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000311766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029780.3-587s21c1
Sequence:CCGGCAAGCAATACTATCCGGGTTTCTCGAGAAACCCGGATAGTATTGCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002880
VALIDATED
RAF1 MISSION shRNA Bacterial Glycerol Stock
v-raf-1 murine leukemia viral oncogene homolog 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.2-1986s1c1
Sequence:CCGGCTACTCCTATGGCATCGTATTCTCGAGAATACGATGCCATAGGAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.2-2862s1c1
Sequence:CCGGGCTTTGGTACTATGGAACTTTCTCGAGAAAGTTCCATAGTACCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002880.2-745s1c1
Sequence:CCGGGCTGCGTCTTTGATTGGAGAACTCGAGTTCTCCAATCAAAGACGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.2-1750s1c1
Sequence:CCGGGCTCAGGGAATGGACTATTTGCTCGAGCAAATAGTCCATTCCCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002880.x-1236s1c1
Sequence:CCGGCGGAGATGTTGCAGTAAAGATCTCGAGATCTTTACTGCAACATCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.2-2220s1c1
Sequence:CCGGCCAACACTCTCTACCGAAGATCTCGAGATCTTCGGTAGAGAGTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.x-2399s1c1
Sequence:CCGGCATGAGTATTTAGAGGAAGTACTCGAGTACTTCCTCTAAATACTCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.x-1529s1c1
Sequence:CCGGGAGACATGAAATCCAACAATACTCGAGTATTGTTGGATTTCATGTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002880.x-321s1c1
Sequence:CCGGCAAGCAAAGAACAGTGGTCAACTCGAGTTGACCACTGTTCTTTGCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.x-1764s1c1
Sequence:CCGGGCTTCCTTATTCTCACATCAACTCGAGTTGATGTGAGAATAAGGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002880
VALIDATED
RAF1 MISSION shRNA shRNA Plasmid DNA
v-raf-1 murine leukemia viral oncogene homolog 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.2-1986s1c1
Sequence:CCGGCTACTCCTATGGCATCGTATTCTCGAGAATACGATGCCATAGGAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.2-2862s1c1
Sequence:CCGGGCTTTGGTACTATGGAACTTTCTCGAGAAAGTTCCATAGTACCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002880.2-745s1c1
Sequence:CCGGGCTGCGTCTTTGATTGGAGAACTCGAGTTCTCCAATCAAAGACGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.2-1750s1c1
Sequence:CCGGGCTCAGGGAATGGACTATTTGCTCGAGCAAATAGTCCATTCCCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002880.x-1236s1c1
Sequence:CCGGCGGAGATGTTGCAGTAAAGATCTCGAGATCTTTACTGCAACATCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.2-2220s1c1
Sequence:CCGGCCAACACTCTCTACCGAAGATCTCGAGATCTTCGGTAGAGAGTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.x-2399s1c1
Sequence:CCGGCATGAGTATTTAGAGGAAGTACTCGAGTACTTCCTCTAAATACTCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.x-1529s1c1
Sequence:CCGGGAGACATGAAATCCAACAATACTCGAGTATTGTTGGATTTCATGTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002880.x-321s1c1
Sequence:CCGGCAAGCAAAGAACAGTGGTCAACTCGAGTTGACCACTGTTCTTTGCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.x-1764s1c1
Sequence:CCGGGCTTCCTTATTCTCACATCAACTCGAGTTGATGTGAGAATAAGGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002880
VALIDATED
RAF1 MISSION shRNA Lentiviral Transduction Particles
v-raf-1 murine leukemia viral oncogene homolog 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.2-1986s1c1
Sequence:CCGGCTACTCCTATGGCATCGTATTCTCGAGAATACGATGCCATAGGAGTAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000196264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.2-2862s1c1
Sequence:CCGGGCTTTGGTACTATGGAACTTTCTCGAGAAAGTTCCATAGTACCAAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000196969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002880.2-745s1c1
Sequence:CCGGGCTGCGTCTTTGATTGGAGAACTCGAGTTCTCCAATCAAAGACGCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000197115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.2-1750s1c1
Sequence:CCGGGCTCAGGGAATGGACTATTTGCTCGAGCAAATAGTCCATTCCCTGAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002880.x-1236s1c1
Sequence:CCGGCGGAGATGTTGCAGTAAAGATCTCGAGATCTTTACTGCAACATCTCCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000195646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.2-2220s1c1
Sequence:CCGGCCAACACTCTCTACCGAAGATCTCGAGATCTTCGGTAGAGAGTGTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.x-2399s1c1
Sequence:CCGGCATGAGTATTTAGAGGAAGTACTCGAGTACTTCCTCTAAATACTCATGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.x-1529s1c1
Sequence:CCGGGAGACATGAAATCCAACAATACTCGAGTATTGTTGGATTTCATGTCTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002880.x-321s1c1
Sequence:CCGGCAAGCAAAGAACAGTGGTCAACTCGAGTTGACCACTGTTCTTTGCTTGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002880.x-1764s1c1
Sequence:CCGGGCTTCCTTATTCTCACATCAACTCGAGTTGATGTGAGAATAAGGAAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???