EMAIL THIS PAGE TO A FRIEND

RAG2

recombination activating gene 2

67 Gene Product Result for
Synonyms: RAG-2
UniProtKB ID: P55895, A8K9E9, Q8TBL4
Gene ID:
Human(5897) Summary: This gene encodes a protein that is involved in the initiation of V(D)J recombination during B and T cell development. This protein forms a complex with the product of the adjacent recombination activating gene 1, and this complex can form double-strand breaks by cleaving DNA at conserved recombination signal sequences. The recombination activating gene 1 component is thought to contain most of the catalytic activity, while the N-terminal of the recombination activating gene 2 component is thought to form a six-bladed propeller in the active core that serves as a binding scaffold for the tight association of the complex with DNA. A C-terminal plant homeodomain finger-like motif in this protein is necessary for interactions with chromatin components, specifically with histone H3 that is trimethylated at lysine 4. Mutations in this gene cause Omenn syndrome, a form of severe combined immunodeficiency associated with autoimmune-like symptoms. [provided by RefSeq, Jul 2008]
Mouse(19374) recombination activating gene 2
Rat(295953) recombination activating gene 2
domestic guinea pig(100723894) recombination activating gene 2
Domestic Rabbit(100328951) recombination activating gene 2
naked mole-rat(101724205) recombination activating gene 2
cow(782387) recombination activating gene 2
sheep(101107628) recombination activating gene 2
Zebrafish(30658) recombination activating gene 2
domestic cat(101096513) recombination activating gene 2
domestic cat(493757) recombination activating gene 2
dog(483419) recombination activating gene 2
chicken(423165) recombination activating gene 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009020 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009020 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009020 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000536 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000681 MISSION® esiRNA esiRNA targeting human RAG2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000536 Rosetta Predictions human pricing
XM_001079235 Rosetta Predictions rat pricing
XM_230374 Rosetta Predictions rat pricing
NM_009020 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128097 predicted 1606
2 SASI_Hs01_00128098 predicted 1751
3 SASI_Hs01_00128099 predicted 1172
4 SASI_Hs02_00302753 predicted 194
5 SASI_Hs01_00128101 predicted 1782
6 SASI_Hs02_00302754 predicted 1133
7 SASI_Hs01_00128102 predicted 1598
8 SASI_Hs01_00128104 predicted 416
9 SASI_Hs01_00128105 predicted 565
10 SASI_Hs01_00128106 predicted 1036
11 SASI_Hs01_00128100 predicted 582
12 SASI_Hs01_00128103 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363623 predicted 539
2 SASI_Rn02_00363624 predicted 270
3 SASI_Rn02_00363625 predicted 256
4 SASI_Rn02_00363626 predicted 1632
5 SASI_Rn02_00363627 predicted 1251
6 SASI_Rn02_00363628 predicted 933
7 SASI_Rn02_00363629 predicted 404
8 SASI_Rn02_00363630 predicted 1838
9 SASI_Rn02_00363631 predicted 620
10 SASI_Rn02_00363632 predicted 1240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230374 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386174 predicted 533
2 SASI_Rn02_00386175 predicted 270
3 SASI_Rn02_00386176 predicted 258
4 SASI_Rn02_00386177 predicted 1635
5 SASI_Rn02_00386178 predicted 1256
6 SASI_Rn02_00386179 predicted 927
7 SASI_Rn02_00386180 predicted 405
8 SASI_Rn02_00386181 predicted 1843
9 SASI_Rn02_00386182 predicted 619
10 SASI_Rn02_00386183 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130960 predicted 1755
2 SASI_Mm01_00130961 predicted 505
3 SASI_Mm01_00130962 predicted 1467
4 SASI_Mm01_00130963 predicted 1625
5 SASI_Mm02_00315170 predicted 1207
6 SASI_Mm01_00130964 predicted 217
7 SASI_Mm01_00130965 predicted 892
8 SASI_Mm01_00130966 predicted 1134
9 SASI_Mm01_00130967 predicted 1823
10 SASI_Mm01_00130968 predicted 467
11 SASI_Mm01_00130969 predicted 850
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009020
RAG2 MISSION shRNA Bacterial Glycerol Stock
recombination activating gene 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009020.2-2446s1c1
Sequence:CCGGCCACACATAGATCCAAGTAATCTCGAGATTACTTGGATCTATGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009020.2-1713s1c1
Sequence:CCGGCCAATGAAATCCCTCCACAAACTCGAGTTTGTGGAGGGATTTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009020.2-1523s1c1
Sequence:CCGGGCTCAATAAACCCGCCATGATCTCGAGATCATGGCGGGTTTATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009020.2-387s1c1
Sequence:CCGGCCTGCAATCTTCTCTAAAGATCTCGAGATCTTTAGAGAAGATTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009020.2-899s1c1
Sequence:CCGGCCCTGCTAACTTGTATAGAATCTCGAGATTCTATACAAGTTAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009020
RAG2 MISSION shRNA shRNA Plasmid DNA
recombination activating gene 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009020.2-2446s1c1
Sequence:CCGGCCACACATAGATCCAAGTAATCTCGAGATTACTTGGATCTATGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009020.2-1713s1c1
Sequence:CCGGCCAATGAAATCCCTCCACAAACTCGAGTTTGTGGAGGGATTTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009020.2-1523s1c1
Sequence:CCGGGCTCAATAAACCCGCCATGATCTCGAGATCATGGCGGGTTTATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009020.2-387s1c1
Sequence:CCGGCCTGCAATCTTCTCTAAAGATCTCGAGATCTTTAGAGAAGATTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009020.2-899s1c1
Sequence:CCGGCCCTGCTAACTTGTATAGAATCTCGAGATTCTATACAAGTTAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009020
RAG2 MISSION shRNA Lentiviral Transduction Particles
recombination activating gene 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009020.2-2446s1c1
Sequence:CCGGCCACACATAGATCCAAGTAATCTCGAGATTACTTGGATCTATGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009020.2-1713s1c1
Sequence:CCGGCCAATGAAATCCCTCCACAAACTCGAGTTTGTGGAGGGATTTCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009020.2-1523s1c1
Sequence:CCGGGCTCAATAAACCCGCCATGATCTCGAGATCATGGCGGGTTTATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009020.2-387s1c1
Sequence:CCGGCCTGCAATCTTCTCTAAAGATCTCGAGATCTTTAGAGAAGATTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009020.2-899s1c1
Sequence:CCGGCCCTGCTAACTTGTATAGAATCTCGAGATTCTATACAAGTTAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000536
RAG2 MISSION shRNA Bacterial Glycerol Stock
recombination activating gene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000536.1-1421s1c1
Sequence:CCGGGCCCTACTTGTGATGTGGATACTCGAGTATCCACATCACAAGTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000536.1-938s1c1
Sequence:CCGGCCAGTGCAATCCTGACTCAAACTCGAGTTTGAGTCAGGATTGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000536.1-1486s1c1
Sequence:CCGGGCCATGATCTACTGCTCTCATCTCGAGATGAGAGCAGTAGATCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000536.1-457s1c1
Sequence:CCGGCCAAACAATGAGGTTTCAGATCTCGAGATCTGAAACCTCATTGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000536.1-1086s1c1
Sequence:CCGGCCCAGACATTAAGCACAGCAACTCGAGTTGCTGTGCTTAATGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000536
RAG2 MISSION shRNA shRNA Plasmid DNA
recombination activating gene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000536.1-1421s1c1
Sequence:CCGGGCCCTACTTGTGATGTGGATACTCGAGTATCCACATCACAAGTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000536.1-938s1c1
Sequence:CCGGCCAGTGCAATCCTGACTCAAACTCGAGTTTGAGTCAGGATTGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000536.1-1486s1c1
Sequence:CCGGGCCATGATCTACTGCTCTCATCTCGAGATGAGAGCAGTAGATCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000536.1-457s1c1
Sequence:CCGGCCAAACAATGAGGTTTCAGATCTCGAGATCTGAAACCTCATTGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000536.1-1086s1c1
Sequence:CCGGCCCAGACATTAAGCACAGCAACTCGAGTTGCTGTGCTTAATGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000536
RAG2 MISSION shRNA Lentiviral Transduction Particles
recombination activating gene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000536.1-1421s1c1
Sequence:CCGGGCCCTACTTGTGATGTGGATACTCGAGTATCCACATCACAAGTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000536.1-938s1c1
Sequence:CCGGCCAGTGCAATCCTGACTCAAACTCGAGTTTGAGTCAGGATTGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000536.1-1486s1c1
Sequence:CCGGGCCATGATCTACTGCTCTCATCTCGAGATGAGAGCAGTAGATCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000536.1-457s1c1
Sequence:CCGGCCAAACAATGAGGTTTCAGATCTCGAGATCTGAAACCTCATTGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000536.1-1086s1c1
Sequence:CCGGCCCAGACATTAAGCACAGCAACTCGAGTTGCTGTGCTTAATGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)