EMAIL THIS PAGE TO A FRIEND

RAI14

retinoic acid induced 14

166 Gene Product Result for
Synonyms: NORPEG RAI13
Gene ID:
Mouse(75646) retinoic acid induced 14
Rat(294804) retinoic acid induced 14
Zebrafish(794796) retinoic acid induced 14
Horse(100068152) retinoic acid induced 14
domestic cat(101081193) retinoic acid induced 14
chicken(427431) retinoic acid induced 14
dog(479368) retinoic acid induced 14
domestic guinea pig(100723180) retinoic acid induced 14
naked mole-rat(101716725) retinoic acid induced 14
cow(525869) retinoic acid induced 14
sheep(101112675) retinoic acid induced 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015577 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015577 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015577 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030690 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030690 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030690 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015577 Rosetta Predictions human pricing
NM_001011947 Rosetta Predictions rat pricing
XM_574862 Rosetta Predictions rat pricing
NM_030690 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124237 predicted 2362
2 SASI_Hs02_00348162 predicted 1188
3 SASI_Hs02_00348163 predicted 2102
4 SASI_Hs02_00348164 predicted 2110
5 SASI_Hs01_00124240 predicted 1251
6 SASI_Hs01_00124241 predicted 2191
7 SASI_Hs01_00124242 predicted 326
8 SASI_Hs01_00124243 predicted 2436
9 SASI_Hs01_00124244 predicted 2489
10 SASI_Hs01_00124245 predicted 430
11 SASI_Hs01_00124238 predicted 2509
12 SASI_Hs01_00124239 predicted 2301
13 SASI_Hs01_00124246 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034555 predicted 1909
2 SASI_Rn01_00034556 predicted 1098
3 SASI_Rn01_00034557 predicted 1896
4 SASI_Rn01_00034558 predicted 500
5 SASI_Rn02_00199963 predicted 2955
6 SASI_Rn01_00034559 predicted 1486
7 SASI_Rn01_00034560 predicted 1151
8 SASI_Rn01_00034561 predicted 541
9 SASI_Rn01_00034562 predicted 2845
10 SASI_Rn01_00034563 predicted 316
11 SASI_Rn01_00034554 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00185980 predicted 326
2 SASI_Rn01_00185981 predicted 1938
3 SASI_Rn01_00185982 predicted 1136
4 SASI_Rn01_00185983 predicted 1929
5 SASI_Rn01_00185984 predicted 448
6 SASI_Rn01_00185985 predicted 1522
7 SASI_Rn01_00185986 predicted 1188
8 SASI_Rn01_00185987 predicted 491
9 SASI_Rn01_00185988 predicted 269
10 SASI_Rn01_00185989 predicted 1181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336856 predicted 1318
2 SASI_Mm01_00083486 predicted 635
3 SASI_Mm01_00083487 predicted 2145
4 SASI_Mm01_00083489 predicted 2059
5 SASI_Mm01_00083490 predicted 2632
6 SASI_Mm01_00083491 predicted 1170
7 SASI_Mm01_00083492 predicted 1713
8 SASI_Mm01_00083493 predicted 1901
9 SASI_Mm01_00083494 predicted 894
10 SASI_Mm01_00083495 predicted 828
11 SASI_Mm01_00083488 predicted 2684
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015577
VALIDATED
RAI14 MISSION shRNA Bacterial Glycerol Stock
retinoic acid induced 14
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015577.1-2512s21c1
Sequence:CCGGAGTGTGTTGGCATCGAAATTACTCGAGTAATTTCGATGCCAACACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015577.1-736s1c1
Sequence:CCGGGCAGACCTAAACCTTGTAGATCTCGAGATCTACAAGGTTTAGGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015577.1-549s1c1
Sequence:CCGGCCTCAAAGATTTGGATGGGAACTCGAGTTCCCATCCAAATCTTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015577.1-3123s21c1
Sequence:CCGGCCGCTGCCATTGTTCTCATTCCTCGAGGAATGAGAACAATGGCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015577.1-1831s21c1
Sequence:CCGGGAAGAGTACGAGGAAATGAAACTCGAGTTTCATTTCCTCGTACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015577.1-3406s1c1
Sequence:CCGGGCAGTGAATGCTCCTTCCATTCTCGAGAATGGAAGGAGCATTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015577.1-3165s1c1
Sequence:CCGGCGTAGCTTCTTCCCTTTCCAACTCGAGTTGGAAAGGGAAGAAGCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015577.1-1009s21c1
Sequence:CCGGTCGGGAAAGGAATCGGTATTTCTCGAGAAATACCGATTCCTTTCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_015577.1-1109s21c1
Sequence:CCGGCTGATAGCTTATTGGATATAACTCGAGTTATATCCAATAAGCTATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015577.1-1831s1c1
Sequence:CCGGGAAGAGTACGAGGAAATGAAACTCGAGTTTCATTTCCTCGTACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015577.1-2254s1c1
Sequence:CCGGCAGCTCAAACAACTGGTGGATCTCGAGATCCACCAGTTGTTTGAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015577
VALIDATED
RAI14 MISSION shRNA shRNA Plasmid DNA
retinoic acid induced 14
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015577.1-2512s21c1
Sequence:CCGGAGTGTGTTGGCATCGAAATTACTCGAGTAATTTCGATGCCAACACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015577.1-736s1c1
Sequence:CCGGGCAGACCTAAACCTTGTAGATCTCGAGATCTACAAGGTTTAGGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015577.1-549s1c1
Sequence:CCGGCCTCAAAGATTTGGATGGGAACTCGAGTTCCCATCCAAATCTTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015577.1-3123s21c1
Sequence:CCGGCCGCTGCCATTGTTCTCATTCCTCGAGGAATGAGAACAATGGCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015577.1-1831s21c1
Sequence:CCGGGAAGAGTACGAGGAAATGAAACTCGAGTTTCATTTCCTCGTACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015577.1-3406s1c1
Sequence:CCGGGCAGTGAATGCTCCTTCCATTCTCGAGAATGGAAGGAGCATTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015577.1-3165s1c1
Sequence:CCGGCGTAGCTTCTTCCCTTTCCAACTCGAGTTGGAAAGGGAAGAAGCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015577.1-1009s21c1
Sequence:CCGGTCGGGAAAGGAATCGGTATTTCTCGAGAAATACCGATTCCTTTCCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_015577.1-1109s21c1
Sequence:CCGGCTGATAGCTTATTGGATATAACTCGAGTTATATCCAATAAGCTATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015577.1-1831s1c1
Sequence:CCGGGAAGAGTACGAGGAAATGAAACTCGAGTTTCATTTCCTCGTACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015577.1-2254s1c1
Sequence:CCGGCAGCTCAAACAACTGGTGGATCTCGAGATCCACCAGTTGTTTGAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015577
VALIDATED
RAI14 MISSION shRNA Lentiviral Transduction Particles
retinoic acid induced 14
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015577.1-2512s21c1
Sequence:CCGGAGTGTGTTGGCATCGAAATTACTCGAGTAATTTCGATGCCAACACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015577.1-736s1c1
Sequence:CCGGGCAGACCTAAACCTTGTAGATCTCGAGATCTACAAGGTTTAGGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015577.1-549s1c1
Sequence:CCGGCCTCAAAGATTTGGATGGGAACTCGAGTTCCCATCCAAATCTTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_015577.1-3123s21c1
Sequence:CCGGCCGCTGCCATTGTTCTCATTCCTCGAGGAATGAGAACAATGGCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015577.1-1831s21c1
Sequence:CCGGGAAGAGTACGAGGAAATGAAACTCGAGTTTCATTTCCTCGTACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015577.1-3406s1c1
Sequence:CCGGGCAGTGAATGCTCCTTCCATTCTCGAGAATGGAAGGAGCATTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015577.1-3165s1c1
Sequence:CCGGCGTAGCTTCTTCCCTTTCCAACTCGAGTTGGAAAGGGAAGAAGCTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015577.1-1009s21c1
Sequence:CCGGTCGGGAAAGGAATCGGTATTTCTCGAGAAATACCGATTCCTTTCCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_015577.1-1109s21c1
Sequence:CCGGCTGATAGCTTATTGGATATAACTCGAGTTATATCCAATAAGCTATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015577.1-1831s1c1
Sequence:CCGGGAAGAGTACGAGGAAATGAAACTCGAGTTTCATTTCCTCGTACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015577.1-2254s1c1
Sequence:CCGGCAGCTCAAACAACTGGTGGATCTCGAGATCCACCAGTTGTTTGAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030690
VALIDATED
RAI14 MISSION shRNA Bacterial Glycerol Stock
retinoic acid induced 14
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030690.2-1989s21c1
Sequence:CCGGACTGCTCTGTTATCGAGAATACTCGAGTATTCTCGATAACAGAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030690.2-2068s21c1
Sequence:CCGGGAAACTGAAGGACACGCTAAACTCGAGTTTAGCGTGTCCTTCAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030690.2-834s21c1
Sequence:CCGGCGAACACTGTGGACGCCTTAACTCGAGTTAAGGCGTCCACAGTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030690.2-4645s21c1
Sequence:CCGGAGGATTTGCCACGGGACTTAACTCGAGTTAAGTCCCGTGGCAAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030690.2-759s21c1
Sequence:CCGGATCACGGCGCAGATGTCAATTCTCGAGAATTGACATCTGCGCCGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030690.2-4309s1c1
Sequence:CCGGCGACCTTACTTTCAGGTTGAACTCGAGTTCAACCTGAAAGTAAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030690.2-2252s1c1
Sequence:CCGGGCAGCCGAGTACATTCACAAACTCGAGTTTGTGAATGTACTCGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030690.2-1238s1c1
Sequence:CCGGGCTGACAGCTTGTTGGATATACTCGAGTATATCCAACAAGCTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030690.2-2631s1c1
Sequence:CCGGGCGAAGTCAATGCCTTAGCAACTCGAGTTGCTAAGGCATTGACTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030690.2-1309s1c1
Sequence:CCGGCGCTTCCCTTACCTTACACAACTCGAGTTGTGTAAGGTAAGGGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030690
VALIDATED
RAI14 MISSION shRNA shRNA Plasmid DNA
retinoic acid induced 14
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030690.2-1989s21c1
Sequence:CCGGACTGCTCTGTTATCGAGAATACTCGAGTATTCTCGATAACAGAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030690.2-2068s21c1
Sequence:CCGGGAAACTGAAGGACACGCTAAACTCGAGTTTAGCGTGTCCTTCAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030690.2-834s21c1
Sequence:CCGGCGAACACTGTGGACGCCTTAACTCGAGTTAAGGCGTCCACAGTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030690.2-4645s21c1
Sequence:CCGGAGGATTTGCCACGGGACTTAACTCGAGTTAAGTCCCGTGGCAAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030690.2-759s21c1
Sequence:CCGGATCACGGCGCAGATGTCAATTCTCGAGAATTGACATCTGCGCCGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030690.2-4309s1c1
Sequence:CCGGCGACCTTACTTTCAGGTTGAACTCGAGTTCAACCTGAAAGTAAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030690.2-2252s1c1
Sequence:CCGGGCAGCCGAGTACATTCACAAACTCGAGTTTGTGAATGTACTCGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030690.2-1238s1c1
Sequence:CCGGGCTGACAGCTTGTTGGATATACTCGAGTATATCCAACAAGCTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030690.2-2631s1c1
Sequence:CCGGGCGAAGTCAATGCCTTAGCAACTCGAGTTGCTAAGGCATTGACTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030690.2-1309s1c1
Sequence:CCGGCGCTTCCCTTACCTTACACAACTCGAGTTGTGTAAGGTAAGGGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030690
VALIDATED
RAI14 MISSION shRNA Lentiviral Transduction Particles
retinoic acid induced 14
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030690.2-1989s21c1
Sequence:CCGGACTGCTCTGTTATCGAGAATACTCGAGTATTCTCGATAACAGAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030690.2-2068s21c1
Sequence:CCGGGAAACTGAAGGACACGCTAAACTCGAGTTTAGCGTGTCCTTCAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030690.2-834s21c1
Sequence:CCGGCGAACACTGTGGACGCCTTAACTCGAGTTAAGGCGTCCACAGTGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030690.2-4645s21c1
Sequence:CCGGAGGATTTGCCACGGGACTTAACTCGAGTTAAGTCCCGTGGCAAATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030690.2-759s21c1
Sequence:CCGGATCACGGCGCAGATGTCAATTCTCGAGAATTGACATCTGCGCCGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030690.2-4309s1c1
Sequence:CCGGCGACCTTACTTTCAGGTTGAACTCGAGTTCAACCTGAAAGTAAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030690.2-2252s1c1
Sequence:CCGGGCAGCCGAGTACATTCACAAACTCGAGTTTGTGAATGTACTCGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030690.2-1238s1c1
Sequence:CCGGGCTGACAGCTTGTTGGATATACTCGAGTATATCCAACAAGCTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030690.2-2631s1c1
Sequence:CCGGGCGAAGTCAATGCCTTAGCAACTCGAGTTGCTAAGGCATTGACTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030690.2-1309s1c1
Sequence:CCGGCGCTTCCCTTACCTTACACAACTCGAGTTGTGTAAGGTAAGGGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)