EMAIL THIS PAGE TO A FRIEND

RALB

v-ral simian leukemia viral oncogene homolog B

91 Gene Product Result for
UniProtKB ID: P11234, Q53T32
Gene ID:
Human(5899) Summary: This gene encodes a GTP-binding protein that belongs to the small GTPase superfamily and Ras family of proteins. GTP-binding proteins mediate the transmembrane signaling initiated by the occupancy of certain cell surface receptors. [provided by RefSeq, Jul 2008]
Mouse(64143) v-ral simian leukemia viral oncogene homolog B (ras related)
Rat(116546) v-ral simian leukemia viral oncogene homolog B
chicken(424237) v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein)
domestic cat(101080471) v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein)
dog(483881) v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein)
cow(505238) v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein)
Goat(100861145) v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein)
sheep(101113566) v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein)
naked mole-rat(101699253) v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein)
domestic guinea pig(100715093) v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002881 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002881 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002881 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022327 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022327 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022327 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002881 Rosetta Predictions human pricing
NM_053821 Rosetta Predictions rat pricing
NM_022327 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334659 predicted 502
2 SASI_Hs01_00242021 predicted 413
3 SASI_Hs01_00242022 predicted 1075
4 SASI_Hs02_00334660 predicted 449
5 SASI_Hs01_00242023 predicted 294
6 SASI_Hs01_00242024 predicted 999
7 SASI_Hs01_00242025 predicted 262
8 SASI_Hs01_00242026 predicted 1270
9 SASI_Hs01_00242029 predicted 319
10 SASI_Hs01_00242030 predicted 400
11 SASI_Hs01_00242027 predicted 342
12 SASI_Hs01_00242028 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053821 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088768 predicted 921
2 SASI_Rn01_00088769 predicted 362
3 SASI_Rn01_00088770 predicted 711
4 SASI_Rn01_00088771 predicted 383
5 SASI_Rn02_00266655 predicted 1220
6 SASI_Rn01_00088772 predicted 1099
7 SASI_Rn01_00088774 predicted 451
8 SASI_Rn01_00088775 predicted 951
9 SASI_Rn01_00088776 predicted 793
10 SASI_Rn01_00088777 predicted 1100
11 SASI_Rn01_00088773 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022327 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088313 predicted 1021
2 SASI_Mm01_00088314 predicted 885
3 SASI_Mm02_00326566 predicted 970
4 SASI_Mm02_00326567 predicted 273
5 SASI_Mm01_00088315 predicted 994
6 SASI_Mm01_00088317 predicted 245
7 SASI_Mm01_00088318 predicted 425
8 SASI_Mm01_00088319 predicted 196
9 SASI_Mm01_00088320 predicted 1084
10 SASI_Mm01_00088321 predicted 338
11 SASI_Mm01_00088316 predicted 587
12 SASI_Mm01_00088322 predicted 1036
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002881
VALIDATED
RALB MISSION shRNA Bacterial Glycerol Stock
v-ral simian leukemia viral oncogene homolog B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002881.2-302s1c1
Sequence:CCGGGAGTTTGTAGAAGACTATGAACTCGAGTTCATAGTCTTCTACAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002881.2-302s21c1
Sequence:CCGGGAGTTTGTAGAAGACTATGAACTCGAGTTCATAGTCTTCTACAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002881.2-1755s1c1
Sequence:CCGGCGTGATGAGTTAAAGTTGTATCTCGAGATACAACTTTAACTCATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002881.2-419s1c1
Sequence:CCGGGCCATTCGAGATAACTACTTTCTCGAGAAAGTAGTTATCTCGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002881.2-688s1c1
Sequence:CCGGCAAGGTGTTCTTTGACCTAATCTCGAGATTAGGTCAAAGAACACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002881.2-688s21c1
Sequence:CCGGCAAGGTGTTCTTTGACCTAATCTCGAGATTAGGTCAAAGAACACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002881.2-489s21c1
Sequence:CCGGCCTTTACAGCAACTGCCGAATCTCGAGATTCGGCAGTTGCTGTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002881.2-489s1c1
Sequence:CCGGCCTTTACAGCAACTGCCGAATCTCGAGATTCGGCAGTTGCTGTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002881.2-1755s21c1
Sequence:CCGGCGTGATGAGTTAAAGTTGTATCTCGAGATACAACTTTAACTCATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002881.2-419s21c1
Sequence:CCGGGCCATTCGAGATAACTACTTTCTCGAGAAAGTAGTTATCTCGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002881
VALIDATED
RALB MISSION shRNA shRNA Plasmid DNA
v-ral simian leukemia viral oncogene homolog B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002881.2-302s1c1
Sequence:CCGGGAGTTTGTAGAAGACTATGAACTCGAGTTCATAGTCTTCTACAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002881.2-302s21c1
Sequence:CCGGGAGTTTGTAGAAGACTATGAACTCGAGTTCATAGTCTTCTACAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002881.2-1755s1c1
Sequence:CCGGCGTGATGAGTTAAAGTTGTATCTCGAGATACAACTTTAACTCATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002881.2-419s1c1
Sequence:CCGGGCCATTCGAGATAACTACTTTCTCGAGAAAGTAGTTATCTCGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002881.2-688s1c1
Sequence:CCGGCAAGGTGTTCTTTGACCTAATCTCGAGATTAGGTCAAAGAACACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002881.2-688s21c1
Sequence:CCGGCAAGGTGTTCTTTGACCTAATCTCGAGATTAGGTCAAAGAACACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002881.2-489s21c1
Sequence:CCGGCCTTTACAGCAACTGCCGAATCTCGAGATTCGGCAGTTGCTGTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002881.2-489s1c1
Sequence:CCGGCCTTTACAGCAACTGCCGAATCTCGAGATTCGGCAGTTGCTGTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002881.2-1755s21c1
Sequence:CCGGCGTGATGAGTTAAAGTTGTATCTCGAGATACAACTTTAACTCATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002881.2-419s21c1
Sequence:CCGGGCCATTCGAGATAACTACTTTCTCGAGAAAGTAGTTATCTCGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002881
VALIDATED
RALB MISSION shRNA Lentiviral Transduction Particles
v-ral simian leukemia viral oncogene homolog B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002881.2-302s1c1
Sequence:CCGGGAGTTTGTAGAAGACTATGAACTCGAGTTCATAGTCTTCTACAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002881.2-302s21c1
Sequence:CCGGGAGTTTGTAGAAGACTATGAACTCGAGTTCATAGTCTTCTACAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072953    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002881.2-1755s1c1
Sequence:CCGGCGTGATGAGTTAAAGTTGTATCTCGAGATACAACTTTAACTCATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002881.2-419s1c1
Sequence:CCGGGCCATTCGAGATAACTACTTTCTCGAGAAAGTAGTTATCTCGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002881.2-688s1c1
Sequence:CCGGCAAGGTGTTCTTTGACCTAATCTCGAGATTAGGTCAAAGAACACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002881.2-688s21c1
Sequence:CCGGCAAGGTGTTCTTTGACCTAATCTCGAGATTAGGTCAAAGAACACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002881.2-489s21c1
Sequence:CCGGCCTTTACAGCAACTGCCGAATCTCGAGATTCGGCAGTTGCTGTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002881.2-489s1c1
Sequence:CCGGCCTTTACAGCAACTGCCGAATCTCGAGATTCGGCAGTTGCTGTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002881.2-1755s21c1
Sequence:CCGGCGTGATGAGTTAAAGTTGTATCTCGAGATACAACTTTAACTCATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002881.2-419s21c1
Sequence:CCGGGCCATTCGAGATAACTACTTTCTCGAGAAAGTAGTTATCTCGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022327
RALB MISSION shRNA Bacterial Glycerol Stock
v-ral simian leukemia viral oncogene homolog B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022327.3-1056s1c1
Sequence:CCGGCGGTCATCTTTCCTTAGGAAACTCGAGTTTCCTAAGGAAAGATGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022327.3-617s1c1
Sequence:CCGGGATGAGAGAAATCCGGGCAAACTCGAGTTTGCCCGGATTTCTCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022327.3-134s1c1
Sequence:CCGGCCTGGTACTTCACAAGGTCATCTCGAGATGACCTTGTGAAGTACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022327.3-599s1c1
Sequence:CCGGCAAGGTATTCTTTGATCTGATCTCGAGATCAGATCAAAGAATACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022327.4-133s21c1
Sequence:CCGGCCTGGTACTTCACAAGGTCATCTCGAGATGACCTTGTGAAGTACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022327.4-598s21c1
Sequence:CCGGCAAGGTATTCTTTGATCTGATCTCGAGATCAGATCAAAGAATACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022327.3-222s1c1
Sequence:CCGGGAAGACTATGAGCCCACCAAACTCGAGTTTGGTGGGCTCATAGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022327.4-1055s21c1
Sequence:CCGGCGGTCATCTTTCCTTAGGAAACTCGAGTTTCCTAAGGAAAGATGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022327.4-616s21c1
Sequence:CCGGGATGAGAGAAATCCGGGCAAACTCGAGTTTGCCCGGATTTCTCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022327
RALB MISSION shRNA shRNA Plasmid DNA
v-ral simian leukemia viral oncogene homolog B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022327.3-1056s1c1
Sequence:CCGGCGGTCATCTTTCCTTAGGAAACTCGAGTTTCCTAAGGAAAGATGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022327.3-617s1c1
Sequence:CCGGGATGAGAGAAATCCGGGCAAACTCGAGTTTGCCCGGATTTCTCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022327.3-134s1c1
Sequence:CCGGCCTGGTACTTCACAAGGTCATCTCGAGATGACCTTGTGAAGTACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022327.3-599s1c1
Sequence:CCGGCAAGGTATTCTTTGATCTGATCTCGAGATCAGATCAAAGAATACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022327.4-133s21c1
Sequence:CCGGCCTGGTACTTCACAAGGTCATCTCGAGATGACCTTGTGAAGTACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022327.4-598s21c1
Sequence:CCGGCAAGGTATTCTTTGATCTGATCTCGAGATCAGATCAAAGAATACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022327.3-222s1c1
Sequence:CCGGGAAGACTATGAGCCCACCAAACTCGAGTTTGGTGGGCTCATAGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022327.4-1055s21c1
Sequence:CCGGCGGTCATCTTTCCTTAGGAAACTCGAGTTTCCTAAGGAAAGATGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022327.4-616s21c1
Sequence:CCGGGATGAGAGAAATCCGGGCAAACTCGAGTTTGCCCGGATTTCTCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022327
RALB MISSION shRNA Lentiviral Transduction Particles
v-ral simian leukemia viral oncogene homolog B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022327.3-1056s1c1
Sequence:CCGGCGGTCATCTTTCCTTAGGAAACTCGAGTTTCCTAAGGAAAGATGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022327.3-617s1c1
Sequence:CCGGGATGAGAGAAATCCGGGCAAACTCGAGTTTGCCCGGATTTCTCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022327.3-134s1c1
Sequence:CCGGCCTGGTACTTCACAAGGTCATCTCGAGATGACCTTGTGAAGTACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022327.3-599s1c1
Sequence:CCGGCAAGGTATTCTTTGATCTGATCTCGAGATCAGATCAAAGAATACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022327.4-133s21c1
Sequence:CCGGCCTGGTACTTCACAAGGTCATCTCGAGATGACCTTGTGAAGTACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022327.4-598s21c1
Sequence:CCGGCAAGGTATTCTTTGATCTGATCTCGAGATCAGATCAAAGAATACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022327.3-222s1c1
Sequence:CCGGGAAGACTATGAGCCCACCAAACTCGAGTTTGGTGGGCTCATAGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022327.4-1055s21c1
Sequence:CCGGCGGTCATCTTTCCTTAGGAAACTCGAGTTTCCTAAGGAAAGATGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022327.4-616s21c1
Sequence:CCGGGATGAGAGAAATCCGGGCAAACTCGAGTTTGCCCGGATTTCTCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)