EMAIL THIS PAGE TO A FRIEND

RALGAPB

Ral GTPase activating protein, beta subunit (non-catalytic)

92 Gene Product Result for
Synonyms: KIAA1219 RalGAPbeta dJ1100H13.1
Gene ID:
Mouse(228850) Ral GTPase activating protein, beta subunit (non-catalytic)
Rat(362257) Ral GTPase activating protein, beta subunit (non-catalytic)
cow(787596) Ral GTPase activating protein, beta subunit (non-catalytic)
sheep(101104846) Ral GTPase activating protein, beta subunit (non-catalytic)
naked mole-rat(101725900) Ral GTPase activating protein, beta subunit (non-catalytic)
domestic guinea pig(100731648) Ral GTPase activating protein, beta subunit (non-catalytic)
Zebrafish(559303) Ral GTPase activating protein, beta subunit (non-catalytic)
chicken(419128) Ral GTPase activating protein, beta subunit (non-catalytic)
Horse(100070219) Ral GTPase activating protein, beta subunit (non-catalytic)
domestic cat(101097385) Ral GTPase activating protein, beta subunit (non-catalytic)
dog(612869) Ral GTPase activating protein, beta subunit (non-catalytic)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA051454 Anti-RALGAPB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020336 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177658 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177658 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177658 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020336 Rosetta Predictions human pricing
XM_342562 Rosetta Predictions rat pricing
NM_177658 Rosetta Predictions mouse pricing
XM_001005860 Rosetta Predictions mouse pricing
XM_283803 Rosetta Predictions mouse pricing
XM_902776 Rosetta Predictions mouse pricing
XM_902779 Rosetta Predictions mouse pricing
XM_902782 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164574 predicted 4452
2 SASI_Hs01_00164576 predicted 4358
3 SASI_Hs01_00164577 predicted 2400
4 SASI_Hs02_00353261 predicted 4715
5 SASI_Hs01_00164578 predicted 2084
6 SASI_Hs01_00164579 predicted 702
7 SASI_Hs01_00164580 predicted 4172
8 SASI_Hs02_00353262 predicted 3890
9 SASI_Hs01_00164581 predicted 2823
10 SASI_Hs01_00164582 predicted 4392
11 SASI_Hs01_00164575 predicted 3656
12 SASI_Hs01_00164583 predicted 2840
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342562 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00162166 predicted 2481
2 SASI_Rn01_00162167 predicted 3976
3 SASI_Rn01_00162168 predicted 1805
4 SASI_Rn01_00162169 predicted 1612
5 SASI_Rn01_00162170 predicted 971
6 SASI_Rn01_00162171 predicted 745
7 SASI_Rn01_00162172 predicted 1825
8 SASI_Rn01_00162173 predicted 3921
9 SASI_Rn01_00162174 predicted 3890
10 SASI_Rn01_00162175 predicted 4270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347945 predicted 4458
2 SASI_Mm02_00347946 predicted 4380
3 SASI_Mm02_00347947 predicted 2301
4 SASI_Mm02_00347948 predicted 2271
5 SASI_Mm02_00347949 predicted 4411
6 SASI_Mm02_00347950 predicted 2966
7 SASI_Mm02_00347951 predicted 1630
8 SASI_Mm02_00347952 predicted 4611
9 SASI_Mm02_00347953 predicted 1011
10 SASI_Mm02_00347954 predicted 4188
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203786 predicted 861
2 SASI_Mm01_00203787 predicted 2310
3 SASI_Mm01_00203788 predicted 2279
4 SASI_Mm01_00203789 predicted 2336
5 SASI_Mm01_00203790 predicted 2984
6 SASI_Mm01_00203791 predicted 1634
7 SASI_Mm01_00203792 predicted 1017
8 SASI_Mm01_00203793 predicted 4209
9 SASI_Mm01_00203794 predicted 1593
10 SASI_Mm01_00203795 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211677 predicted 2487
2 SASI_Mm01_00211678 predicted 4445
3 SASI_Mm01_00211679 predicted 4365
4 SASI_Mm01_00211680 predicted 2279
5 SASI_Mm01_00211681 predicted 2249
6 SASI_Mm01_00211682 predicted 4390
7 SASI_Mm01_00211683 predicted 1636
8 SASI_Mm01_00211684 predicted 1015
9 SASI_Mm01_00211685 predicted 4167
10 SASI_Mm01_00211686 predicted 1603
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211308 predicted 1105
2 SASI_Mm01_00211309 predicted 1773
3 SASI_Mm01_00211310 predicted 857
4 SASI_Mm01_00211311 predicted 1814
5 SASI_Mm01_00211312 predicted 556
6 SASI_Mm01_00211313 predicted 1626
7 SASI_Mm01_00211314 predicted 1017
8 SASI_Mm01_00211315 predicted 1597
9 SASI_Mm01_00211316 predicted 618
10 SASI_Mm01_00211317 predicted 1273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274590 predicted 2085
2 SASI_Mm01_00274591 predicted 857
3 SASI_Mm01_00274592 predicted 2305
4 SASI_Mm01_00274593 predicted 2275
5 SASI_Mm01_00274594 predicted 2338
6 SASI_Mm01_00274595 predicted 2989
7 SASI_Mm01_00274596 predicted 1636
8 SASI_Mm01_00274597 predicted 1014
9 SASI_Mm01_00274598 predicted 1603
10 SASI_Mm01_00274599 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902782 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280614 predicted 4476
2 SASI_Mm01_00280615 predicted 4399
3 SASI_Mm01_00280616 predicted 855
4 SASI_Mm01_00280617 predicted 2312
5 SASI_Mm01_00280618 predicted 2275
6 SASI_Mm01_00280619 predicted 2334
7 SASI_Mm01_00280620 predicted 4427
8 SASI_Mm01_00280621 predicted 1635
9 SASI_Mm01_00280622 predicted 1017
10 SASI_Mm01_00280623 predicted 4203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020336
VALIDATED
RALGAPB MISSION shRNA Bacterial Glycerol Stock
Ral GTPase activating protein, beta subunit (non-catalytic)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020336.1-1032s1c1
Sequence:CCGGGCATTTAAAGTTCCCGATGAACTCGAGTTCATCGGGAACTTTAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020336.2-5156s21c1
Sequence:CCGGAGAATCTTACAGGACATTTAACTCGAGTTAAATGTCCTGTAAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020336.2-1212s21c1
Sequence:CCGGCCGCAAGAATTGAATCAGTATCTCGAGATACTGATTCAATTCTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020336.1-1212s1c1
Sequence:CCGGCCGCAAGAATTGAATCAGTATCTCGAGATACTGATTCAATTCTTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020336.1-1859s1c1
Sequence:CCGGGCCAGCTTATTTATCCAGATTCTCGAGAATCTGGATAAATAAGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020336.1-1617s1c1
Sequence:CCGGGCAGCATTTGTTCACTGTAAACTCGAGTTTACAGTGAACAAATGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020336.1-4176s1c1
Sequence:CCGGCCCAATCATACAGACAATCTTCTCGAGAAGATTGTCTGTATGATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_020336.1-734s1c1
Sequence:CCGGCCGAGAAACTTGGGAAGTCTTCTCGAGAAGACTTCCCAAGTTTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020336.2-2404s21c1
Sequence:CCGGGTCGCACCAATAGTGGTATTACTCGAGTAATACCACTATTGGTGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020336.2-1617s21c1
Sequence:CCGGGCAGCATTTGTTCACTGTAAACTCGAGTTTACAGTGAACAAATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020336.2-1143s21c1
Sequence:CCGGTTGAGTAACCCAGCTATTATACTCGAGTATAATAGCTGGGTTACTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020336
VALIDATED
RALGAPB MISSION shRNA shRNA Plasmid DNA
Ral GTPase activating protein, beta subunit (non-catalytic)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020336.1-1032s1c1
Sequence:CCGGGCATTTAAAGTTCCCGATGAACTCGAGTTCATCGGGAACTTTAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020336.2-5156s21c1
Sequence:CCGGAGAATCTTACAGGACATTTAACTCGAGTTAAATGTCCTGTAAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020336.2-1212s21c1
Sequence:CCGGCCGCAAGAATTGAATCAGTATCTCGAGATACTGATTCAATTCTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020336.1-1212s1c1
Sequence:CCGGCCGCAAGAATTGAATCAGTATCTCGAGATACTGATTCAATTCTTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020336.1-1859s1c1
Sequence:CCGGGCCAGCTTATTTATCCAGATTCTCGAGAATCTGGATAAATAAGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020336.1-1617s1c1
Sequence:CCGGGCAGCATTTGTTCACTGTAAACTCGAGTTTACAGTGAACAAATGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020336.1-4176s1c1
Sequence:CCGGCCCAATCATACAGACAATCTTCTCGAGAAGATTGTCTGTATGATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_020336.1-734s1c1
Sequence:CCGGCCGAGAAACTTGGGAAGTCTTCTCGAGAAGACTTCCCAAGTTTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020336.2-2404s21c1
Sequence:CCGGGTCGCACCAATAGTGGTATTACTCGAGTAATACCACTATTGGTGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020336.2-1617s21c1
Sequence:CCGGGCAGCATTTGTTCACTGTAAACTCGAGTTTACAGTGAACAAATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020336.2-1143s21c1
Sequence:CCGGTTGAGTAACCCAGCTATTATACTCGAGTATAATAGCTGGGTTACTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020336
VALIDATED
RALGAPB MISSION shRNA Lentiviral Transduction Particles
Ral GTPase activating protein, beta subunit (non-catalytic)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020336.1-1032s1c1
Sequence:CCGGGCATTTAAAGTTCCCGATGAACTCGAGTTCATCGGGAACTTTAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020336.2-5156s21c1
Sequence:CCGGAGAATCTTACAGGACATTTAACTCGAGTTAAATGTCCTGTAAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020336.2-1212s21c1
Sequence:CCGGCCGCAAGAATTGAATCAGTATCTCGAGATACTGATTCAATTCTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020336.1-1212s1c1
Sequence:CCGGCCGCAAGAATTGAATCAGTATCTCGAGATACTGATTCAATTCTTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020336.1-1859s1c1
Sequence:CCGGGCCAGCTTATTTATCCAGATTCTCGAGAATCTGGATAAATAAGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_020336.1-1617s1c1
Sequence:CCGGGCAGCATTTGTTCACTGTAAACTCGAGTTTACAGTGAACAAATGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020336.1-4176s1c1
Sequence:CCGGCCCAATCATACAGACAATCTTCTCGAGAAGATTGTCTGTATGATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_020336.1-734s1c1
Sequence:CCGGCCGAGAAACTTGGGAAGTCTTCTCGAGAAGACTTCCCAAGTTTCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020336.2-2404s21c1
Sequence:CCGGGTCGCACCAATAGTGGTATTACTCGAGTAATACCACTATTGGTGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020336.2-1617s21c1
Sequence:CCGGGCAGCATTTGTTCACTGTAAACTCGAGTTTACAGTGAACAAATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020336.2-1143s21c1
Sequence:CCGGTTGAGTAACCCAGCTATTATACTCGAGTATAATAGCTGGGTTACTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177658
VALIDATED
RALGAPB MISSION shRNA Bacterial Glycerol Stock
Ral GTPase activating protein, beta subunit (non-catalytic)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177658.3-1875s21c1
Sequence:CCGGGAGATTCTGCCAGCTTATTTACTCGAGTAAATAAGCTGGCAGAATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177658.3-3620s21c1
Sequence:CCGGTTTATCCTTAGAGGCATTAAACTCGAGTTTAATGCCTCTAAGGATAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177658.3-7649s21c1
Sequence:CCGGTAGGGACTGCCTTGGATATTACTCGAGTAATATCCAAGGCAGTCCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177658.3-588s21c1
Sequence:CCGGTCTATTCCATTACCCATTATTCTCGAGAATAATGGGTAATGGAATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177658.3-4570s21c1
Sequence:CCGGTGGTGAGGCAGACGGTAATAACTCGAGTTATTACCGTCTGCCTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177658
VALIDATED
RALGAPB MISSION shRNA shRNA Plasmid DNA
Ral GTPase activating protein, beta subunit (non-catalytic)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177658.3-1875s21c1
Sequence:CCGGGAGATTCTGCCAGCTTATTTACTCGAGTAAATAAGCTGGCAGAATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177658.3-3620s21c1
Sequence:CCGGTTTATCCTTAGAGGCATTAAACTCGAGTTTAATGCCTCTAAGGATAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177658.3-7649s21c1
Sequence:CCGGTAGGGACTGCCTTGGATATTACTCGAGTAATATCCAAGGCAGTCCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177658.3-588s21c1
Sequence:CCGGTCTATTCCATTACCCATTATTCTCGAGAATAATGGGTAATGGAATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177658.3-4570s21c1
Sequence:CCGGTGGTGAGGCAGACGGTAATAACTCGAGTTATTACCGTCTGCCTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177658
VALIDATED
RALGAPB MISSION shRNA Lentiviral Transduction Particles
Ral GTPase activating protein, beta subunit (non-catalytic)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177658.3-1875s21c1
Sequence:CCGGGAGATTCTGCCAGCTTATTTACTCGAGTAAATAAGCTGGCAGAATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177658.3-3620s21c1
Sequence:CCGGTTTATCCTTAGAGGCATTAAACTCGAGTTTAATGCCTCTAAGGATAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177658.3-7649s21c1
Sequence:CCGGTAGGGACTGCCTTGGATATTACTCGAGTAATATCCAAGGCAGTCCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177658.3-588s21c1
Sequence:CCGGTCTATTCCATTACCCATTATTCTCGAGAATAATGGGTAATGGAATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177658.3-4570s21c1
Sequence:CCGGTGGTGAGGCAGACGGTAATAACTCGAGTTATTACCGTCTGCCTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)