EMAIL THIS PAGE TO A FRIEND

RALGPS2

Ral GEF with PH domain and SH3 binding motif 2

90 Gene Product Result for
Synonyms: dJ595C2.1
UniProtKB ID: Q86X27, Q5T5Z1, Q5VZ67, Q9NW78
Gene ID:
Mouse(78255) Ral GEF with PH domain and SH3 binding motif 2
Rat(304887) Ral GEF with PH domain and SH3 binding motif 2
Zebrafish(393446) Ral-A exchange factor RalGPS2
Horse(100052879) Ral GEF with PH domain and SH3 binding motif 2
domestic cat(101101101) Ral GEF with PH domain and SH3 binding motif 2
dog(480054) Ral GEF with PH domain and SH3 binding motif 2
chicken(424429) Ral GEF with PH domain and SH3 binding motif 2
domestic guinea pig(100726496) Ral GEF with PH domain and SH3 binding motif 2
naked mole-rat(101708446) Ral GEF with PH domain and SH3 binding motif 2
cow(789713) Ral GEF with PH domain and SH3 binding motif 2
sheep(101119920) Ral GEF with PH domain and SH3 binding motif 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152663 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018037 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018037 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018037 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018037 Rosetta Predictions human pricing
NM_152663 Rosetta Predictions human pricing
NM_001100680 Rosetta Predictions rat pricing
NM_023884 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160002 predicted 576
2 SASI_Hs01_00160004 predicted 580
3 SASI_Hs01_00160005 predicted 840
4 SASI_Hs01_00160007 predicted 444
5 SASI_Hs01_00160008 predicted 522
6 SASI_Hs01_00160009 predicted 379
7 SASI_Hs01_00160010 predicted 839
8 SASI_Hs02_00351154 predicted 569
9 SASI_Hs02_00351155 predicted 523
10 SASI_Hs02_00351156 predicted 658
11 SASI_Hs01_00160003 predicted 443
12 SASI_Hs01_00160006 predicted 871
13 SASI_Hs01_00160011 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031798 predicted 653
2 SASI_Hs01_00031800 predicted 653
3 SASI_Hs01_00031801 predicted 920
4 SASI_Hs01_00031803 predicted 517
5 SASI_Hs01_00031804 predicted 602
6 SASI_Hs01_00031805 predicted 455
7 SASI_Hs01_00031806 predicted 925
8 SASI_Hs02_00366553 predicted 645
9 SASI_Hs02_00366554 predicted 608
10 SASI_Hs02_00366555 predicted 741
11 SASI_Hs01_00031799 predicted 522
12 SASI_Hs01_00031802 predicted 955
13 SASI_Hs01_00031807 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210298 predicted 332
2 SASI_Rn02_00210299 predicted 825
3 SASI_Rn02_00210300 predicted 279
4 SASI_Rn02_00210301 predicted 885
5 SASI_Rn02_00210302 predicted 715
6 SASI_Rn02_00210303 predicted 466
7 SASI_Rn02_00210304 predicted 312
8 SASI_Rn02_00210305 predicted 621
9 SASI_Rn02_00210306 predicted 960
10 SASI_Rn02_00210307 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029940 predicted 1905
2 SASI_Mm01_00029941 predicted 676
3 SASI_Mm01_00029942 predicted 1405
4 SASI_Mm01_00029943 predicted 1893
5 SASI_Mm02_00327433 predicted 1619
6 SASI_Mm01_00029944 predicted 707
7 SASI_Mm01_00029945 predicted 274
8 SASI_Mm01_00029946 predicted 579
9 SASI_Mm01_00029947 predicted 1388
10 SASI_Mm01_00029948 predicted 546
11 SASI_Mm01_00029949 predicted 1299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152663
RALGPS2 MISSION shRNA Bacterial Glycerol Stock
Ral GEF with PH domain and SH3 binding motif 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000423067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152663.3-1615s21c1
Sequence:CCGGTGACAAGAGTGGCACGAAATGCTCGAGCATTTCGTGCCACTCTTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152663.3-1360s21c1
Sequence:CCGGGCCATAGTTTGGGTTATAATTCTCGAGAATTATAACCCAAACTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152663.3-2418s21c1
Sequence:CCGGGGAATAGATCGTAGCTAATTTCTCGAGAAATTAGCTACGATCTATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152663.3-898s21c1
Sequence:CCGGGAGACTATATAAGTAGCTTAACTCGAGTTAAGCTACTTATATAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152663
RALGPS2 MISSION shRNA shRNA Plasmid DNA
Ral GEF with PH domain and SH3 binding motif 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000423067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152663.3-1615s21c1
Sequence:CCGGTGACAAGAGTGGCACGAAATGCTCGAGCATTTCGTGCCACTCTTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152663.3-1360s21c1
Sequence:CCGGGCCATAGTTTGGGTTATAATTCTCGAGAATTATAACCCAAACTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152663.3-2418s21c1
Sequence:CCGGGGAATAGATCGTAGCTAATTTCTCGAGAAATTAGCTACGATCTATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152663.3-898s21c1
Sequence:CCGGGAGACTATATAAGTAGCTTAACTCGAGTTAAGCTACTTATATAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152663
RALGPS2 MISSION shRNA Lentiviral Transduction Particles
Ral GEF with PH domain and SH3 binding motif 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000423067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152663.3-1615s21c1
Sequence:CCGGTGACAAGAGTGGCACGAAATGCTCGAGCATTTCGTGCCACTCTTGTCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000416506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152663.3-1360s21c1
Sequence:CCGGGCCATAGTTTGGGTTATAATTCTCGAGAATTATAACCCAAACTATGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152663.3-2418s21c1
Sequence:CCGGGGAATAGATCGTAGCTAATTTCTCGAGAAATTAGCTACGATCTATTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000413161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152663.3-898s21c1
Sequence:CCGGGAGACTATATAAGTAGCTTAACTCGAGTTAAGCTACTTATATAGTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023884
VALIDATED
RALGPS2 MISSION shRNA Bacterial Glycerol Stock
Ral GEF with PH domain and SH3 binding motif 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023884.3-1897s21c1
Sequence:CCGGGACAGAAGAGGAGTGCTATTGCTCGAGCAATAGCACTCCTCTTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023884.3-581s21c1
Sequence:CCGGACTAAGACGTGGGCGTTATTACTCGAGTAATAACGCCCACGTCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110110    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023884.2-2585s1c1
Sequence:CCGGCCAGGGTTAAAGTTTAACTTTCTCGAGAAAGTTAAACTTTAACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023884.2-276s1c1
Sequence:CCGGCGCGGGTCAGATAACACTAATCTCGAGATTAGTGTTATCTGACCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023884.2-1334s1c1
Sequence:CCGGGCAGTGATGGTTCTGAACTAACTCGAGTTAGTTCAGAACCATCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023884.2-1659s1c1
Sequence:CCGGGCATTTCAAATCAACGTCAAACTCGAGTTTGACGTTGATTTGAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023884.2-483s1c1
Sequence:CCGGCCACTATATTAAGACTGCTAACTCGAGTTAGCAGTCTTAATATAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023884.3-274s21c1
Sequence:CCGGCGCGGGTCAGATAACACTAATCTCGAGATTAGTGTTATCTGACCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023884.3-1332s21c1
Sequence:CCGGGCAGTGATGGTTCTGAACTAACTCGAGTTAGTTCAGAACCATCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023884
VALIDATED
RALGPS2 MISSION shRNA shRNA Plasmid DNA
Ral GEF with PH domain and SH3 binding motif 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023884.3-1897s21c1
Sequence:CCGGGACAGAAGAGGAGTGCTATTGCTCGAGCAATAGCACTCCTCTTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023884.3-581s21c1
Sequence:CCGGACTAAGACGTGGGCGTTATTACTCGAGTAATAACGCCCACGTCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110110    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023884.2-2585s1c1
Sequence:CCGGCCAGGGTTAAAGTTTAACTTTCTCGAGAAAGTTAAACTTTAACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023884.2-276s1c1
Sequence:CCGGCGCGGGTCAGATAACACTAATCTCGAGATTAGTGTTATCTGACCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023884.2-1334s1c1
Sequence:CCGGGCAGTGATGGTTCTGAACTAACTCGAGTTAGTTCAGAACCATCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023884.2-1659s1c1
Sequence:CCGGGCATTTCAAATCAACGTCAAACTCGAGTTTGACGTTGATTTGAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023884.2-483s1c1
Sequence:CCGGCCACTATATTAAGACTGCTAACTCGAGTTAGCAGTCTTAATATAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023884.3-274s21c1
Sequence:CCGGCGCGGGTCAGATAACACTAATCTCGAGATTAGTGTTATCTGACCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023884.3-1332s21c1
Sequence:CCGGGCAGTGATGGTTCTGAACTAACTCGAGTTAGTTCAGAACCATCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023884
VALIDATED
RALGPS2 MISSION shRNA Lentiviral Transduction Particles
Ral GEF with PH domain and SH3 binding motif 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023884.3-1897s21c1
Sequence:CCGGGACAGAAGAGGAGTGCTATTGCTCGAGCAATAGCACTCCTCTTCTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023884.3-581s21c1
Sequence:CCGGACTAAGACGTGGGCGTTATTACTCGAGTAATAACGCCCACGTCTTAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000110110    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023884.2-2585s1c1
Sequence:CCGGCCAGGGTTAAAGTTTAACTTTCTCGAGAAAGTTAAACTTTAACCCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000110113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023884.2-276s1c1
Sequence:CCGGCGCGGGTCAGATAACACTAATCTCGAGATTAGTGTTATCTGACCCGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000110114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023884.2-1334s1c1
Sequence:CCGGGCAGTGATGGTTCTGAACTAACTCGAGTTAGTTCAGAACCATCACTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000110112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023884.2-1659s1c1
Sequence:CCGGGCATTTCAAATCAACGTCAAACTCGAGTTTGACGTTGATTTGAAATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000110111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023884.2-483s1c1
Sequence:CCGGCCACTATATTAAGACTGCTAACTCGAGTTAGCAGTCTTAATATAGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000288398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023884.3-274s21c1
Sequence:CCGGCGCGGGTCAGATAACACTAATCTCGAGATTAGTGTTATCTGACCCGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000288331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023884.3-1332s21c1
Sequence:CCGGGCAGTGATGGTTCTGAACTAACTCGAGTTAGTTCAGAACCATCACTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018037
RALGPS2 MISSION shRNA Bacterial Glycerol Stock
Ral GEF with PH domain and SH3 binding motif 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018037.1-856s1c1
Sequence:CCGGCATTCCCTATTTAGGTATCTACTCGAGTAGATACCTAAATAGGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018037.1-648s1c1
Sequence:CCGGAGAAACTGTATGAGCTGAATACTCGAGTATTCAGCTCATACAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018037.1-413s1c1
Sequence:CCGGGAAGAATATGCGGGTCAGATACTCGAGTATCTGACCCGCATATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018037.1-990s1c1
Sequence:CCGGAGCAGTCTTGTGAATATGATACTCGAGTATCATATTCACAAGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018037.1-478s1c1
Sequence:CCGGGCTTTCAAGTTGTGGATGGAACTCGAGTTCCATCCACAACTTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018037
RALGPS2 MISSION shRNA shRNA Plasmid DNA
Ral GEF with PH domain and SH3 binding motif 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018037.1-856s1c1
Sequence:CCGGCATTCCCTATTTAGGTATCTACTCGAGTAGATACCTAAATAGGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018037.1-648s1c1
Sequence:CCGGAGAAACTGTATGAGCTGAATACTCGAGTATTCAGCTCATACAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018037.1-413s1c1
Sequence:CCGGGAAGAATATGCGGGTCAGATACTCGAGTATCTGACCCGCATATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018037.1-990s1c1
Sequence:CCGGAGCAGTCTTGTGAATATGATACTCGAGTATCATATTCACAAGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018037.1-478s1c1
Sequence:CCGGGCTTTCAAGTTGTGGATGGAACTCGAGTTCCATCCACAACTTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018037
RALGPS2 MISSION shRNA Lentiviral Transduction Particles
Ral GEF with PH domain and SH3 binding motif 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018037.1-856s1c1
Sequence:CCGGCATTCCCTATTTAGGTATCTACTCGAGTAGATACCTAAATAGGGAATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000047285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018037.1-648s1c1
Sequence:CCGGAGAAACTGTATGAGCTGAATACTCGAGTATTCAGCTCATACAGTTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000047287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018037.1-413s1c1
Sequence:CCGGGAAGAATATGCGGGTCAGATACTCGAGTATCTGACCCGCATATTCTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000047286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018037.1-990s1c1
Sequence:CCGGAGCAGTCTTGTGAATATGATACTCGAGTATCATATTCACAAGACTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000047283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018037.1-478s1c1
Sequence:CCGGGCTTTCAAGTTGTGGATGGAACTCGAGTTCCATCCACAACTTGAAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???