EMAIL THIS PAGE TO A FRIEND

RALYL

RALY RNA binding protein-like

83 Gene Product Result for
Synonyms: HNRPCL3
UniProtKB ID: Q86SE5, B3KTH2, Q6ZW87, Q8N1C2
Gene ID:
Mouse(76897) RALY RNA binding protein-like
Rat(294883) RALY RNA binding protein-like
chicken(420203) RALY RNA binding protein-like
dog(487025) RALY RNA binding protein-like
domestic cat(101093081) RALY RNA binding protein-like
naked mole-rat(101702145) RALY RNA binding protein-like
cow(516989) RALY RNA binding protein-like
sheep(101114878) RALY RNA binding protein-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173848 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178631 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178631 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178631 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021411 MISSION® esiRNA esiRNA human RALYL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100391 Rosetta Predictions human pricing
NM_001100392 Rosetta Predictions human pricing
NM_001100393 Rosetta Predictions human pricing
NM_173848 Rosetta Predictions human pricing
NM_001024978 Rosetta Predictions rat pricing
NM_178631 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321874 predicted 866
2 SASI_Hs02_00321875 predicted 748
3 SASI_Hs02_00321876 predicted 723
4 SASI_Hs02_00321877 predicted 983
5 SASI_Hs02_00321878 predicted 445
6 SASI_Hs02_00321879 predicted 882
7 SASI_Hs02_00321880 predicted 896
8 SASI_Hs02_00321881 predicted 432
9 SASI_Hs02_00321882 predicted 919
10 SASI_Hs02_00321883 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321884 predicted 1106
2 SASI_Hs02_00321885 predicted 994
3 SASI_Hs02_00321886 predicted 961
4 SASI_Hs02_00321887 predicted 1226
5 SASI_Hs02_00321888 predicted 686
6 SASI_Hs02_00321889 predicted 1129
7 SASI_Hs02_00321890 predicted 1147
8 SASI_Hs02_00321891 predicted 681
9 SASI_Hs02_00321892 predicted 1157
10 SASI_Hs02_00321893 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321894 predicted 1075
2 SASI_Hs02_00321895 predicted 959
3 SASI_Hs02_00321896 predicted 933
4 SASI_Hs02_00321897 predicted 1198
5 SASI_Hs02_00321898 predicted 656
6 SASI_Hs02_00321899 predicted 1098
7 SASI_Hs02_00321900 predicted 1113
8 SASI_Hs02_00321901 predicted 649
9 SASI_Hs02_00321902 predicted 1122
10 SASI_Hs02_00321903 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162317 predicted 1791
2 SASI_Hs02_00368721 predicted 1672
3 SASI_Hs02_00368722 predicted 1644
4 SASI_Hs01_00162319 predicted 1913
5 SASI_Hs02_00368723 predicted 1369
6 SASI_Hs02_00368724 predicted 1808
7 SASI_Hs01_00162323 predicted 1819
8 SASI_Hs02_00368725 predicted 1362
9 SASI_Hs02_00368726 predicted 1836
10 SASI_Hs02_00368727 predicted 1807
11 SASI_Hs01_00162316 predicted 1462
12 SASI_Hs01_00162318 predicted 1260
13 SASI_Hs01_00162320 predicted 1416
14 SASI_Hs01_00162321 predicted 1264
15 SASI_Hs01_00162322 predicted 1806
16 SASI_Hs01_00162324 predicted 1245
17 SASI_Hs01_00162325 predicted 1492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061422 predicted 826
2 SASI_Rn01_00061423 predicted 408
3 SASI_Rn01_00061424 predicted 394
4 SASI_Rn01_00061425 predicted 620
5 SASI_Rn01_00061426 predicted 787
6 SASI_Rn01_00061428 predicted 385
7 SASI_Rn01_00061429 predicted 622
8 SASI_Rn01_00061430 predicted 564
9 SASI_Rn01_00061431 predicted 647
10 SASI_Rn02_00202852 predicted 539
11 SASI_Rn01_00061427 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125244 predicted 1717
2 SASI_Mm01_00125245 predicted 1704
3 SASI_Mm01_00125246 predicted 1837
4 SASI_Mm01_00125247 predicted 1547
5 SASI_Mm01_00125248 predicted 1497
6 SASI_Mm01_00125249 predicted 1697
7 SASI_Mm01_00125250 predicted 2007
8 SASI_Mm01_00125252 predicted 1847
9 SASI_Mm02_00349000 predicted 1859
10 SASI_Mm01_00125253 predicted 1716
11 SASI_Mm01_00125251 predicted 1868
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173848
RALYL MISSION shRNA Bacterial Glycerol Stock
RALY RNA binding protein-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173848.5-1496s21c1
Sequence:CCGGTGATTTCTACAATCGGTTATTCTCGAGAATAACCGATTGTAGAAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173848.5-2316s21c1
Sequence:CCGGGTTTCACTGTTGATCATATATCTCGAGATATATGATCAACAGTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173848.5-1647s21c1
Sequence:CCGGAGTGGGTCAACAGGTTCTAAACTCGAGTTTAGAACCTGTTGACCCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173848.5-1449s21c1
Sequence:CCGGTTCCTGTCTGTTGGCGGTTATCTCGAGATAACCGCCAACAGACAGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173848.3-1248s1c1
Sequence:CCGGTGTTCCGTTCACAAAGGTTATCTCGAGATAACCTTTGTGAACGGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173848.3-2059s1c1
Sequence:CCGGGCAGCATCTTTGGTTCAATTTCTCGAGAAATTGAACCAAAGATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173848.3-1618s1c1
Sequence:CCGGCCATGAAAGGTGGATCGAGATCTCGAGATCTCGATCCACCTTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173848.3-1172s1c1
Sequence:CCGGCGGCAATCTAAATACGGCAATCTCGAGATTGCCGTATTTAGATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173848.3-1785s1c1
Sequence:CCGGGCTCAGAAGAAGCAATTGGAACTCGAGTTCCAATTGCTTCTTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173848
RALYL MISSION shRNA shRNA Plasmid DNA
RALY RNA binding protein-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173848.5-1496s21c1
Sequence:CCGGTGATTTCTACAATCGGTTATTCTCGAGAATAACCGATTGTAGAAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173848.5-2316s21c1
Sequence:CCGGGTTTCACTGTTGATCATATATCTCGAGATATATGATCAACAGTGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173848.5-1647s21c1
Sequence:CCGGAGTGGGTCAACAGGTTCTAAACTCGAGTTTAGAACCTGTTGACCCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173848.5-1449s21c1
Sequence:CCGGTTCCTGTCTGTTGGCGGTTATCTCGAGATAACCGCCAACAGACAGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173848.3-1248s1c1
Sequence:CCGGTGTTCCGTTCACAAAGGTTATCTCGAGATAACCTTTGTGAACGGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173848.3-2059s1c1
Sequence:CCGGGCAGCATCTTTGGTTCAATTTCTCGAGAAATTGAACCAAAGATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173848.3-1618s1c1
Sequence:CCGGCCATGAAAGGTGGATCGAGATCTCGAGATCTCGATCCACCTTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173848.3-1172s1c1
Sequence:CCGGCGGCAATCTAAATACGGCAATCTCGAGATTGCCGTATTTAGATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173848.3-1785s1c1
Sequence:CCGGGCTCAGAAGAAGCAATTGGAACTCGAGTTCCAATTGCTTCTTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173848
RALYL MISSION shRNA Lentiviral Transduction Particles
RALY RNA binding protein-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173848.5-1496s21c1
Sequence:CCGGTGATTTCTACAATCGGTTATTCTCGAGAATAACCGATTGTAGAAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173848.5-2316s21c1
Sequence:CCGGGTTTCACTGTTGATCATATATCTCGAGATATATGATCAACAGTGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173848.5-1647s21c1
Sequence:CCGGAGTGGGTCAACAGGTTCTAAACTCGAGTTTAGAACCTGTTGACCCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173848.5-1449s21c1
Sequence:CCGGTTCCTGTCTGTTGGCGGTTATCTCGAGATAACCGCCAACAGACAGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173848.3-1248s1c1
Sequence:CCGGTGTTCCGTTCACAAAGGTTATCTCGAGATAACCTTTGTGAACGGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173848.3-2059s1c1
Sequence:CCGGGCAGCATCTTTGGTTCAATTTCTCGAGAAATTGAACCAAAGATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173848.3-1618s1c1
Sequence:CCGGCCATGAAAGGTGGATCGAGATCTCGAGATCTCGATCCACCTTTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173848.3-1172s1c1
Sequence:CCGGCGGCAATCTAAATACGGCAATCTCGAGATTGCCGTATTTAGATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173848.3-1785s1c1
Sequence:CCGGGCTCAGAAGAAGCAATTGGAACTCGAGTTCCAATTGCTTCTTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178631
RALYL MISSION shRNA Bacterial Glycerol Stock
RALY RNA binding protein-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178631.2-1518s1c1
Sequence:CCGGCGATTACTACAGAGATGATTTCTCGAGAAATCATCTCTGTAGTAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178631.2-1209s1c1
Sequence:CCGGCGGCAATTTGAATACAGCCATCTCGAGATGGCTGTATTCAAATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178631.2-1992s1c1
Sequence:CCGGCGAGCTGTTTCTACAGATAAACTCGAGTTTATCTGTAGAAACAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178631.2-1467s1c1
Sequence:CCGGGCTTGAATCAAAGGAGCCATTCTCGAGAATGGCTCCTTTGATTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178631.2-2506s1c1
Sequence:CCGGGCTATATTTCTGCCCTCTATACTCGAGTATAGAGGGCAGAAATATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178631
RALYL MISSION shRNA shRNA Plasmid DNA
RALY RNA binding protein-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178631.2-1518s1c1
Sequence:CCGGCGATTACTACAGAGATGATTTCTCGAGAAATCATCTCTGTAGTAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178631.2-1209s1c1
Sequence:CCGGCGGCAATTTGAATACAGCCATCTCGAGATGGCTGTATTCAAATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178631.2-1992s1c1
Sequence:CCGGCGAGCTGTTTCTACAGATAAACTCGAGTTTATCTGTAGAAACAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178631.2-1467s1c1
Sequence:CCGGGCTTGAATCAAAGGAGCCATTCTCGAGAATGGCTCCTTTGATTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178631.2-2506s1c1
Sequence:CCGGGCTATATTTCTGCCCTCTATACTCGAGTATAGAGGGCAGAAATATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178631
RALYL MISSION shRNA Lentiviral Transduction Particles
RALY RNA binding protein-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178631.2-1518s1c1
Sequence:CCGGCGATTACTACAGAGATGATTTCTCGAGAAATCATCTCTGTAGTAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178631.2-1209s1c1
Sequence:CCGGCGGCAATTTGAATACAGCCATCTCGAGATGGCTGTATTCAAATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178631.2-1992s1c1
Sequence:CCGGCGAGCTGTTTCTACAGATAAACTCGAGTTTATCTGTAGAAACAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178631.2-1467s1c1
Sequence:CCGGGCTTGAATCAAAGGAGCCATTCTCGAGAATGGCTCCTTTGATTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178631.2-2506s1c1
Sequence:CCGGGCTATATTTCTGCCCTCTATACTCGAGTATAGAGGGCAGAAATATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)