EMAIL THIS PAGE TO A FRIEND

RAMP3

receptor (G protein-coupled) activity modifying protein 3

48 Gene Product Result for
UniProtKB ID: O60896, Q7Z2Y1
Gene ID:
Human(10268) Summary: The protein encoded by this gene is a member of the RAMP family of single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. RAMPs are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin-gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of this (RAMP3) protein, CRLR functions as an adrenomedullin receptor. [provided by RefSeq, Jul 2008]
Mouse(56089) receptor (calcitonin) activity modifying protein 3
Rat(56820) receptor (G protein-coupled) activity modifying protein 3
chicken(420786) receptor (G protein-coupled) activity modifying protein 3
domestic cat(101101122) receptor (G protein-coupled) activity modifying protein 3
dog(609755) receptor (G protein-coupled) activity modifying protein 3
cow(613547) receptor (G protein-coupled) activity modifying protein 3
sheep(101113582) receptor (G protein-coupled) activity modifying protein 3
naked mole-rat(101710513) receptor (G protein-coupled) activity modifying protein 3
domestic guinea pig(100135612) receptor (calcitonin) activity modifying protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005856 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005856 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005856 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019511 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019511 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019511 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005856 Rosetta Predictions human pricing
NM_020100 Rosetta Predictions rat pricing
NM_019511 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199036 predicted 692
2 SASI_Hs01_00199038 predicted 232
3 SASI_Hs01_00199039 predicted 281
4 SASI_Hs01_00199037 predicted 953
5 SASI_Hs01_00199040 predicted 415
6 SASI_Hs01_00199041 predicted 416
7 SASI_Hs02_00340407 predicted 689
8 SASI_Hs01_00199042 predicted 860
9 SASI_Hs01_00199044 predicted 494
10 SASI_Hs02_00340408 predicted 198
11 SASI_Hs01_00199043 predicted 317
12 SASI_Hs01_00199045 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054004 predicted 606
2 SASI_Rn01_00054006 predicted 691
3 SASI_Rn01_00054007 predicted 771
4 SASI_Rn01_00054008 predicted 944
5 SASI_Rn01_00054009 predicted 399
6 SASI_Rn01_00054010 predicted 205
7 SASI_Rn01_00054011 predicted 254
8 SASI_Rn01_00054012 predicted 418
9 SASI_Rn01_00054013 predicted 663
10 SASI_Rn02_00262509 predicted 312
11 SASI_Rn01_00054005 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019511 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190719 predicted 938
2 SASI_Mm01_00190720 predicted 621
3 SASI_Mm01_00190722 predicted 562
4 SASI_Mm01_00190724 predicted 944
5 SASI_Mm01_00190721 predicted 583
6 SASI_Mm01_00190723 predicted 938
7 SASI_Mm01_00190725 predicted 211
8 SASI_Mm01_00190726 predicted 788
9 SASI_Mm01_00190727 predicted 973
10 SASI_Mm01_00190728 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005856
RAMP3 MISSION shRNA Bacterial Glycerol Stock
receptor (G protein-coupled) activity modifying protein 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005856.1-215s1c1
Sequence:CCGGCATCGTGTACTATGAGAGTTTCTCGAGAAACTCTCATAGTACACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005856.1-393s1c1
Sequence:CCGGCTGATCGTTATACCCGTCGTTCTCGAGAACGACGGGTATAACGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005856.1-207s1c1
Sequence:CCGGTCCGAGTTCATCGTGTACTATCTCGAGATAGTACACGATGAACTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005856.1-377s1c1
Sequence:CCGGCGAGGTTCTCATCCCGCTGATCTCGAGATCAGCGGGATGAGAACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005856.1-152s1c1
Sequence:CCGGGAAGGCTTTCGCAGACATGATCTCGAGATCATGTCTGCGAAAGCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005856.2-143s21c1
Sequence:CCGGTGCAACGAGACAGGCATGTTGCTCGAGCAACATGCCTGTCTCGTTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005856.2-896s21c1
Sequence:CCGGGGACTAGGACTCCTTGCTTGACTCGAGTCAAGCAAGGAGTCCTAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005856.2-964s21c1
Sequence:CCGGGCCTACATCCAGGCAGAAAGACTCGAGTCTTTCTGCCTGGATGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005856
RAMP3 MISSION shRNA shRNA Plasmid DNA
receptor (G protein-coupled) activity modifying protein 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005856.1-215s1c1
Sequence:CCGGCATCGTGTACTATGAGAGTTTCTCGAGAAACTCTCATAGTACACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005856.1-393s1c1
Sequence:CCGGCTGATCGTTATACCCGTCGTTCTCGAGAACGACGGGTATAACGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005856.1-207s1c1
Sequence:CCGGTCCGAGTTCATCGTGTACTATCTCGAGATAGTACACGATGAACTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005856.1-377s1c1
Sequence:CCGGCGAGGTTCTCATCCCGCTGATCTCGAGATCAGCGGGATGAGAACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005856.1-152s1c1
Sequence:CCGGGAAGGCTTTCGCAGACATGATCTCGAGATCATGTCTGCGAAAGCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005856.2-143s21c1
Sequence:CCGGTGCAACGAGACAGGCATGTTGCTCGAGCAACATGCCTGTCTCGTTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005856.2-896s21c1
Sequence:CCGGGGACTAGGACTCCTTGCTTGACTCGAGTCAAGCAAGGAGTCCTAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005856.2-964s21c1
Sequence:CCGGGCCTACATCCAGGCAGAAAGACTCGAGTCTTTCTGCCTGGATGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005856
RAMP3 MISSION shRNA Lentiviral Transduction Particles
receptor (G protein-coupled) activity modifying protein 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005856.1-215s1c1
Sequence:CCGGCATCGTGTACTATGAGAGTTTCTCGAGAAACTCTCATAGTACACGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005856.1-393s1c1
Sequence:CCGGCTGATCGTTATACCCGTCGTTCTCGAGAACGACGGGTATAACGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005856.1-207s1c1
Sequence:CCGGTCCGAGTTCATCGTGTACTATCTCGAGATAGTACACGATGAACTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005856.1-377s1c1
Sequence:CCGGCGAGGTTCTCATCCCGCTGATCTCGAGATCAGCGGGATGAGAACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005856.1-152s1c1
Sequence:CCGGGAAGGCTTTCGCAGACATGATCTCGAGATCATGTCTGCGAAAGCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005856.2-143s21c1
Sequence:CCGGTGCAACGAGACAGGCATGTTGCTCGAGCAACATGCCTGTCTCGTTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005856.2-896s21c1
Sequence:CCGGGGACTAGGACTCCTTGCTTGACTCGAGTCAAGCAAGGAGTCCTAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005856.2-964s21c1
Sequence:CCGGGCCTACATCCAGGCAGAAAGACTCGAGTCTTTCTGCCTGGATGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019511
RAMP3 MISSION shRNA Bacterial Glycerol Stock
receptor (G protein-coupled) activity modifying protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019511.1-167s1c1
Sequence:CCGGCTTCGCTGACATGATGCAGAACTCGAGTTCTGCATCATGTCAGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019511.1-305s1c1
Sequence:CCGGCCAGAGCTTCATCACTGGAATCTCGAGATTCCAGTGATGAAGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019511.1-215s1c1
Sequence:CCGGGTCGGAGTTCATCGTGTATTACTCGAGTAATACACGATGAACTCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019511.1-781s1c1
Sequence:CCGGCCTAGTTTCTAGCCGTTTCTTCTCGAGAAGAAACGGCTAGAAACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019511.1-75s1c1
Sequence:CCGGCCACTGTTGTTGCTGCTTTGTCTCGAGACAAAGCAGCAACAACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019511
RAMP3 MISSION shRNA shRNA Plasmid DNA
receptor (G protein-coupled) activity modifying protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019511.1-167s1c1
Sequence:CCGGCTTCGCTGACATGATGCAGAACTCGAGTTCTGCATCATGTCAGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019511.1-305s1c1
Sequence:CCGGCCAGAGCTTCATCACTGGAATCTCGAGATTCCAGTGATGAAGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019511.1-215s1c1
Sequence:CCGGGTCGGAGTTCATCGTGTATTACTCGAGTAATACACGATGAACTCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019511.1-781s1c1
Sequence:CCGGCCTAGTTTCTAGCCGTTTCTTCTCGAGAAGAAACGGCTAGAAACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019511.1-75s1c1
Sequence:CCGGCCACTGTTGTTGCTGCTTTGTCTCGAGACAAAGCAGCAACAACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019511
RAMP3 MISSION shRNA Lentiviral Transduction Particles
receptor (G protein-coupled) activity modifying protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019511.1-167s1c1
Sequence:CCGGCTTCGCTGACATGATGCAGAACTCGAGTTCTGCATCATGTCAGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019511.1-305s1c1
Sequence:CCGGCCAGAGCTTCATCACTGGAATCTCGAGATTCCAGTGATGAAGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019511.1-215s1c1
Sequence:CCGGGTCGGAGTTCATCGTGTATTACTCGAGTAATACACGATGAACTCCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019511.1-781s1c1
Sequence:CCGGCCTAGTTTCTAGCCGTTTCTTCTCGAGAAGAAACGGCTAGAAACTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019511.1-75s1c1
Sequence:CCGGCCACTGTTGTTGCTGCTTTGTCTCGAGACAAAGCAGCAACAACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)