EMAIL THIS PAGE TO A FRIEND

RAN

RAN, member RAS oncogene family

95 Gene Product Result for
Synonyms: ARA24 Gsp1 TC4
Gene ID:
Human(5901) Summary: RAN (ras-related nuclear protein) is a small GTP binding protein belonging to the RAS superfamily that is essential for the translocation of RNA and proteins through the nuclear pore complex. The RAN protein is also involved in control of DNA synthesis and cell cycle progression. Nuclear localization of RAN requires the presence of regulator of chromosome condensation 1 (RCC1). Mutations in RAN disrupt DNA synthesis. Because of its many functions, it is likely that RAN interacts with several other proteins. RAN regulates formation and organization of the microtubule network independently of its role in the nucleus-cytosol exchange of macromolecules. RAN could be a key signaling molecule regulating microtubule polymerization during mitosis. RCC1 generates a high local concentration of RAN-GTP around chromatin which, in turn, induces the local nucleation of microtubules. RAN is an androgen receptor (AR) coactivator that binds differentially with different lengths of polyglutamine within the androgen receptor. Polyglutamine repeat expansion in the AR is linked to Kennedy's disease (X-linked spinal and bulbar muscular atrophy). RAN coactivation of the AR diminishes with polyglutamine expansion within the AR, and this weak coactivation may lead to partial androgen insensitivity during the development of Kennedy's disease. [provided by RefSeq, Jul 2008]
Mouse(19384) RAN, member RAS oncogene family
Rat(84509) RAN, member RAS oncogene family
cow(540457) RAN, member RAS oncogene family
sheep(100302079) RAN, member RAS oncogene family
naked mole-rat(101711994) RAN, member RAS oncogene family
fruit fly(44072) CG1404 gene product from transcript CG1404-RA
chicken(396193) RAN, member RAS oncogene family
Zebrafish(30572) ras-related nuclear protein
domestic cat(101080666) RAN, member RAS oncogene family
dog(442976) RAN, member RAS oncogene family
dog(100499482) RAN, member RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
07-517 Anti-Ran Antibody serum, clone, Upstate® Xenopus, human
immunocytochemistry, immunoprecipitation (IP), western blot pricing
SAB2500862 Anti-RAN antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, canine, rat, human
ELISA, western blot pricing
SAB2701780 Anti-ran antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2105007 Anti-RAN antibody produced in rabbit affinity isolated antibody horse, rat, pig, sheep, mouse, rabbit, human, bovine, dog
western blot pricing
R4777 Anti-Ran antibody,Mouse monoclonal clone ARAN1, purified from hybridoma cell culture bovine, human, Xenopus, mouse, hamster
ELISA, immunocytochemistry, immunoprecipitation (IP), microarray, western blot pricing
SAB4502579 Anti-RAN, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006325 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006325 Rosetta Predictions human pricing
NM_053439 Rosetta Predictions rat pricing
NM_009391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238745 predicted 963
2 SASI_Hs01_00238746 predicted 961
3 SASI_Hs01_00238747 predicted 382
4 SASI_Hs01_00238748 predicted 950
5 SASI_Hs02_00341355 predicted 470
6 SASI_Hs01_00238749 predicted 511
7 SASI_Hs01_00238750 predicted 690
8 SASI_Hs01_00238751 predicted 314
9 SASI_Hs01_00238753 predicted 845
10 SASI_Hs02_00341356 predicted 397
11 SASI_Hs01_00238752 predicted 989
12 SASI_Hs01_00238754 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053439 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091904 predicted 797
2 SASI_Rn02_00266013 predicted 799
3 SASI_Rn02_00266014 predicted 875
4 SASI_Rn02_00266015 predicted 975
5 SASI_Rn02_00266016 predicted 902
6 SASI_Rn02_00266017 predicted 875
7 SASI_Rn02_00266018 predicted 930
8 SASI_Rn02_00266019 predicted 926
9 SASI_Rn01_00091897 predicted 331
10 SASI_Rn01_00091898 predicted 545
11 SASI_Rn01_00091899 predicted 486
12 SASI_Rn01_00091900 predicted 358
13 SASI_Rn01_00091901 predicted 820
14 SASI_Rn01_00091902 predicted 333
15 SASI_Rn01_00091903 predicted 657
16 SASI_Rn01_00091905 predicted 444
17 SASI_Rn01_00091906 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062915 predicted 403
2 SASI_Mm01_00062916 predicted 429
3 SASI_Mm02_00316012 predicted 201
4 SASI_Mm01_00062917 predicted 500
5 SASI_Mm01_00062918 predicted 874
6 SASI_Mm01_00062919 predicted 995
7 SASI_Mm01_00062920 predicted 970
8 SASI_Mm01_00062921 predicted 991
9 SASI_Mm01_00062922 predicted 857
10 SASI_Mm01_00062924 predicted 865
11 SASI_Mm01_00062923 predicted 883
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006325
VALIDATED
RAN MISSION shRNA Bacterial Glycerol Stock
RAN, member RAS oncogene family
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-869s21c1
Sequence:GTACCGGGAGTGAATGTGGCAGTTTAAACTCGAGTTTAAACTGCCACATTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-224s21c1
Sequence:GTACCGGCACCAACAGAGGACCTATTAACTCGAGTTAATAGGTCCTCTGTTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-346s21c1
Sequence:CCGGCGAGAGTTACTTACAAGAATGCTCGAGCATTCTTGTAAGTAACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-149s21c1
Sequence:CCGGACGTCATTTGACTGGTGAATTCTCGAGAATTCACCAGTCAAATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-576s21c1
Sequence:CCGGGACCCTAACTTGGAATTTGTTCTCGAGAACAAATTCCAAGTTAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-311s21c1
Sequence:GTACCGGAGCCCAGTGTGCCATCATAATCTCGAGATTATGATGGCACACTGGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-284s21c1
Sequence:GTACCGGTGGACTGAGAGATGGCTATTACTCGAGTAATAGCCATCTCTCAGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006325.3-900s21c1
Sequence:GTACCGGATTGTTTGGACCTGCATATTTCTCGAGAAATATGCAGGTCCAAACAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006325.2-198s1c1
Sequence:CCGGACGTCATTTGACTGGTGAATTCTCGAGAATTCACCAGTCAAATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006325.3-648s21c1
Sequence:CCGGGCACAGTATGAGCACGACTTACTCGAGTAAGTCGTGCTCATACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006325.2-697s1c1
Sequence:CCGGGCACAGTATGAGCACGACTTACTCGAGTAAGTCGTGCTCATACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006325.2-142s1c1
Sequence:CCGGCAGTTCAAACTTGTATTGGTTCTCGAGAACCAATACAAGTTTGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006325.2-484s1c1
Sequence:CCGGGTGGATATTAAGGACAGGAAACTCGAGTTTCCTGTCCTTAATATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006325.3-786s21c1
Sequence:CCGGGCGTGTGTGCCACCTCATTATCTCGAGATAATGAGGTGGCACACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006325.2-625s1c1
Sequence:CCGGGACCCTAACTTGGAATTTGTTCTCGAGAACAAATTCCAAGTTAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006325
VALIDATED
RAN MISSION shRNA shRNA Plasmid DNA
RAN, member RAS oncogene family
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-869s21c1
Sequence:GTACCGGGAGTGAATGTGGCAGTTTAAACTCGAGTTTAAACTGCCACATTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-224s21c1
Sequence:GTACCGGCACCAACAGAGGACCTATTAACTCGAGTTAATAGGTCCTCTGTTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-346s21c1
Sequence:CCGGCGAGAGTTACTTACAAGAATGCTCGAGCATTCTTGTAAGTAACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-149s21c1
Sequence:CCGGACGTCATTTGACTGGTGAATTCTCGAGAATTCACCAGTCAAATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-576s21c1
Sequence:CCGGGACCCTAACTTGGAATTTGTTCTCGAGAACAAATTCCAAGTTAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-311s21c1
Sequence:GTACCGGAGCCCAGTGTGCCATCATAATCTCGAGATTATGATGGCACACTGGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-284s21c1
Sequence:GTACCGGTGGACTGAGAGATGGCTATTACTCGAGTAATAGCCATCTCTCAGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006325.3-900s21c1
Sequence:GTACCGGATTGTTTGGACCTGCATATTTCTCGAGAAATATGCAGGTCCAAACAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006325.2-198s1c1
Sequence:CCGGACGTCATTTGACTGGTGAATTCTCGAGAATTCACCAGTCAAATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006325.3-648s21c1
Sequence:CCGGGCACAGTATGAGCACGACTTACTCGAGTAAGTCGTGCTCATACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006325.2-697s1c1
Sequence:CCGGGCACAGTATGAGCACGACTTACTCGAGTAAGTCGTGCTCATACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006325.2-142s1c1
Sequence:CCGGCAGTTCAAACTTGTATTGGTTCTCGAGAACCAATACAAGTTTGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006325.2-484s1c1
Sequence:CCGGGTGGATATTAAGGACAGGAAACTCGAGTTTCCTGTCCTTAATATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006325.3-786s21c1
Sequence:CCGGGCGTGTGTGCCACCTCATTATCTCGAGATAATGAGGTGGCACACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006325.2-625s1c1
Sequence:CCGGGACCCTAACTTGGAATTTGTTCTCGAGAACAAATTCCAAGTTAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006325
VALIDATED
RAN MISSION shRNA Lentiviral Transduction Particles
RAN, member RAS oncogene family
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-869s21c1
Sequence:GTACCGGGAGTGAATGTGGCAGTTTAAACTCGAGTTTAAACTGCCACATTCACTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000379488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-224s21c1
Sequence:GTACCGGCACCAACAGAGGACCTATTAACTCGAGTTAATAGGTCCTCTGTTGGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000296936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-346s21c1
Sequence:CCGGCGAGAGTTACTTACAAGAATGCTCGAGCATTCTTGTAAGTAACTCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000291457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-149s21c1
Sequence:CCGGACGTCATTTGACTGGTGAATTCTCGAGAATTCACCAGTCAAATGACGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000291456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-576s21c1
Sequence:CCGGGACCCTAACTTGGAATTTGTTCTCGAGAACAAATTCCAAGTTAGGGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-311s21c1
Sequence:GTACCGGAGCCCAGTGTGCCATCATAATCTCGAGATTATGATGGCACACTGGGCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000381681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006325.3-284s21c1
Sequence:GTACCGGTGGACTGAGAGATGGCTATTACTCGAGTAATAGCCATCTCTCAGTCCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000380340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006325.3-900s21c1
Sequence:GTACCGGATTGTTTGGACCTGCATATTTCTCGAGAAATATGCAGGTCCAAACAATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000047929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006325.2-198s1c1
Sequence:CCGGACGTCATTTGACTGGTGAATTCTCGAGAATTCACCAGTCAAATGACGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000291458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006325.3-648s21c1
Sequence:CCGGGCACAGTATGAGCACGACTTACTCGAGTAAGTCGTGCTCATACTGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000047928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006325.2-697s1c1
Sequence:CCGGGCACAGTATGAGCACGACTTACTCGAGTAAGTCGTGCTCATACTGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000047932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006325.2-142s1c1
Sequence:CCGGCAGTTCAAACTTGTATTGGTTCTCGAGAACCAATACAAGTTTGAACTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000047930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006325.2-484s1c1
Sequence:CCGGGTGGATATTAAGGACAGGAAACTCGAGTTTCCTGTCCTTAATATCCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000331103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006325.3-786s21c1
Sequence:CCGGGCGTGTGTGCCACCTCATTATCTCGAGATAATGAGGTGGCACACACGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000047931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006325.2-625s1c1
Sequence:CCGGGACCCTAACTTGGAATTTGTTCTCGAGAACAAATTCCAAGTTAGGGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009391
VALIDATED
RAN MISSION shRNA Bacterial Glycerol Stock
RAN, member RAS oncogene family
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009391.2-216s1c1
Sequence:CCGGCCCGCTCGTCTTCCATACCAACTCGAGTTGGTATGGAAGACGAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009391.2-135s1c1
Sequence:CCGGCGGGAAGACAACCTTCGTGAACTCGAGTTCACGAAGGTTGTCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009391.2-373s1c1
Sequence:CCGGGTACCTAACTGGCATAGAGATCTCGAGATCTCTATGCCAGTTAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009391.2-655s1c1
Sequence:CCGGGCACAGTACGAGCATGATTTACTCGAGTAAATCATGCTCGTACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009391.2-489s1c1
Sequence:CCGGCCGGAAGAAGAATCTTCAGTACTCGAGTACTGAAGATTCTTCTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009391
VALIDATED
RAN MISSION shRNA shRNA Plasmid DNA
RAN, member RAS oncogene family
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009391.2-216s1c1
Sequence:CCGGCCCGCTCGTCTTCCATACCAACTCGAGTTGGTATGGAAGACGAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009391.2-135s1c1
Sequence:CCGGCGGGAAGACAACCTTCGTGAACTCGAGTTCACGAAGGTTGTCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009391.2-373s1c1
Sequence:CCGGGTACCTAACTGGCATAGAGATCTCGAGATCTCTATGCCAGTTAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009391.2-655s1c1
Sequence:CCGGGCACAGTACGAGCATGATTTACTCGAGTAAATCATGCTCGTACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009391.2-489s1c1
Sequence:CCGGCCGGAAGAAGAATCTTCAGTACTCGAGTACTGAAGATTCTTCTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009391
VALIDATED
RAN MISSION shRNA Lentiviral Transduction Particles
RAN, member RAS oncogene family
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009391.2-216s1c1
Sequence:CCGGCCCGCTCGTCTTCCATACCAACTCGAGTTGGTATGGAAGACGAGCGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009391.2-135s1c1
Sequence:CCGGCGGGAAGACAACCTTCGTGAACTCGAGTTCACGAAGGTTGTCTTCCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009391.2-373s1c1
Sequence:CCGGGTACCTAACTGGCATAGAGATCTCGAGATCTCTATGCCAGTTAGGTACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009391.2-655s1c1
Sequence:CCGGGCACAGTACGAGCATGATTTACTCGAGTAAATCATGCTCGTACTGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009391.2-489s1c1
Sequence:CCGGCCGGAAGAAGAATCTTCAGTACTCGAGTACTGAAGATTCTTCTTCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???