EMAIL THIS PAGE TO A FRIEND

RANBP10

RAN binding protein 10

265 Gene Product Result for
UniProtKB ID: Q6VN20, A4FTY2, Q9P264
Gene ID:
Mouse(74334) RAN binding protein 10
Rat(361396) RAN binding protein 10
cow(519736) RAN binding protein 10
sheep(101109296) RAN binding protein 10
domestic guinea pig(100729372) RAN binding protein 10
naked mole-rat(101706210) RAN binding protein 10
Zebrafish(793293) RAN binding protein 10
Horse(100066243) RAN binding protein 10
chicken(415653) RAN binding protein 10
dog(489754) RAN binding protein 10
domestic cat(100188928) RAN binding protein 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020850 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020850 Rosetta Predictions human pricing
XM_001073477 Rosetta Predictions rat pricing
XM_341676 Rosetta Predictions rat pricing
NM_145824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213253 predicted 228
2 SASI_Hs01_00213254 predicted 325
3 SASI_Hs01_00213255 predicted 483
4 SASI_Hs01_00213256 predicted 545
5 SASI_Hs01_00213257 predicted 1695
6 SASI_Hs01_00213258 predicted 617
7 SASI_Hs01_00213259 predicted 1638
8 SASI_Hs01_00213260 predicted 1672
9 SASI_Hs01_00213261 predicted 969
10 SASI_Hs01_00213262 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073477 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342986 predicted 1027
2 SASI_Rn02_00342987 predicted 949
3 SASI_Rn02_00342988 predicted 372
4 SASI_Rn02_00342989 predicted 287
5 SASI_Rn02_00342990 predicted 1680
6 SASI_Rn02_00342991 predicted 283
7 SASI_Rn02_00342992 predicted 1774
8 SASI_Rn02_00342993 predicted 562
9 SASI_Rn02_00342994 predicted 576
10 SASI_Rn02_00342995 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393233 predicted 1030
2 SASI_Rn02_00393234 predicted 941
3 SASI_Rn02_00393235 predicted 374
4 SASI_Rn02_00393236 predicted 287
5 SASI_Rn02_00393237 predicted 1682
6 SASI_Rn02_00393238 predicted 284
7 SASI_Rn02_00393239 predicted 1768
8 SASI_Rn02_00393240 predicted 564
9 SASI_Rn02_00393241 predicted 580
10 SASI_Rn02_00393242 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122503 predicted 946
2 SASI_Mm01_00122504 predicted 376
3 SASI_Mm01_00122505 predicted 527
4 SASI_Mm01_00122506 predicted 939
5 SASI_Mm01_00122507 predicted 1769
6 SASI_Mm01_00122509 predicted 287
7 SASI_Mm01_00122510 predicted 790
8 SASI_Mm01_00122511 predicted 285
9 SASI_Mm01_00122512 predicted 574
10 SASI_Mm02_00341289 predicted 662
11 SASI_Mm01_00122508 predicted 1092
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145824
RANBP10 MISSION shRNA Bacterial Glycerol Stock
RAN binding protein 10
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-287s21c1
Sequence:CCGGCGCTTGTACCCTGCGGTTAATCTCGAGATTAACCGCAGGGTACAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-835s21c1
Sequence:CCGGGTTCGACATTGAGGACTATATCTCGAGATATAGTCCTCAATGTCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145824.4-2439s21c1
Sequence:CCGGCAGGTTGATGATAGCTTATTACTCGAGTAATAAGCTATCATCAACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-1024s21c1
Sequence:CCGGGGAAGAGCAGGCATCCATAAACTCGAGTTTATGGATGCCTGCTCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-1829s21c1
Sequence:CCGGCCAGTAGGTCATCAGCTTGATCTCGAGATCAAGCTGATGACCTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-529s21c1
Sequence:CCGGACTCTCAGCGCAAGGCGTTAACTCGAGTTAACGCCTTGCGCTGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145824.3-1830s1c1
Sequence:CCGGCCAGTAGGTCATCAGCTTGATCTCGAGATCAAGCTGATGACCTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145824.3-499s1c1
Sequence:CCGGGCAAAGGAAGAGATGGGTACACTCGAGTGTACCCATCTCTTCCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145824.3-1442s1c1
Sequence:CCGGCGTCAATTACTCCGAGTCCAACTCGAGTTGGACTCGGAGTAATTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-958s21c1
Sequence:CCGGCCTGGTGCATCATGGGTATTGCTCGAGCAATACCCATGATGCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145824.3-387s1c1
Sequence:CCGGCGTGTCCATTACAAAGGTCATCTCGAGATGACCTTTGTAATGGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145824.3-4363s1c1
Sequence:CCGGCCCATTTAATTCTGTGCCTTACTCGAGTAAGGCACAGAATTAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145824
RANBP10 MISSION shRNA shRNA Plasmid DNA
RAN binding protein 10
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-287s21c1
Sequence:CCGGCGCTTGTACCCTGCGGTTAATCTCGAGATTAACCGCAGGGTACAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-835s21c1
Sequence:CCGGGTTCGACATTGAGGACTATATCTCGAGATATAGTCCTCAATGTCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145824.4-2439s21c1
Sequence:CCGGCAGGTTGATGATAGCTTATTACTCGAGTAATAAGCTATCATCAACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-1024s21c1
Sequence:CCGGGGAAGAGCAGGCATCCATAAACTCGAGTTTATGGATGCCTGCTCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-1829s21c1
Sequence:CCGGCCAGTAGGTCATCAGCTTGATCTCGAGATCAAGCTGATGACCTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-529s21c1
Sequence:CCGGACTCTCAGCGCAAGGCGTTAACTCGAGTTAACGCCTTGCGCTGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145824.3-1830s1c1
Sequence:CCGGCCAGTAGGTCATCAGCTTGATCTCGAGATCAAGCTGATGACCTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145824.3-499s1c1
Sequence:CCGGGCAAAGGAAGAGATGGGTACACTCGAGTGTACCCATCTCTTCCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145824.3-1442s1c1
Sequence:CCGGCGTCAATTACTCCGAGTCCAACTCGAGTTGGACTCGGAGTAATTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-958s21c1
Sequence:CCGGCCTGGTGCATCATGGGTATTGCTCGAGCAATACCCATGATGCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145824.3-387s1c1
Sequence:CCGGCGTGTCCATTACAAAGGTCATCTCGAGATGACCTTTGTAATGGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145824.3-4363s1c1
Sequence:CCGGCCCATTTAATTCTGTGCCTTACTCGAGTAAGGCACAGAATTAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145824
RANBP10 MISSION shRNA Lentiviral Transduction Particles
RAN binding protein 10
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-287s21c1
Sequence:CCGGCGCTTGTACCCTGCGGTTAATCTCGAGATTAACCGCAGGGTACAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-835s21c1
Sequence:CCGGGTTCGACATTGAGGACTATATCTCGAGATATAGTCCTCAATGTCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145824.4-2439s21c1
Sequence:CCGGCAGGTTGATGATAGCTTATTACTCGAGTAATAAGCTATCATCAACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-1024s21c1
Sequence:CCGGGGAAGAGCAGGCATCCATAAACTCGAGTTTATGGATGCCTGCTCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-1829s21c1
Sequence:CCGGCCAGTAGGTCATCAGCTTGATCTCGAGATCAAGCTGATGACCTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-529s21c1
Sequence:CCGGACTCTCAGCGCAAGGCGTTAACTCGAGTTAACGCCTTGCGCTGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145824.3-1830s1c1
Sequence:CCGGCCAGTAGGTCATCAGCTTGATCTCGAGATCAAGCTGATGACCTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145824.3-499s1c1
Sequence:CCGGGCAAAGGAAGAGATGGGTACACTCGAGTGTACCCATCTCTTCCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145824.3-1442s1c1
Sequence:CCGGCGTCAATTACTCCGAGTCCAACTCGAGTTGGACTCGGAGTAATTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145824.4-958s21c1
Sequence:CCGGCCTGGTGCATCATGGGTATTGCTCGAGCAATACCCATGATGCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145824.3-387s1c1
Sequence:CCGGCGTGTCCATTACAAAGGTCATCTCGAGATGACCTTTGTAATGGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145824.3-4363s1c1
Sequence:CCGGCCCATTTAATTCTGTGCCTTACTCGAGTAAGGCACAGAATTAAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020850
VALIDATED
RANBP10 MISSION shRNA Bacterial Glycerol Stock
RAN binding protein 10
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020850.1-782s1c1
Sequence:CCGGCCTGTTTGACATTGAGGACTACTCGAGTAGTCCTCAATGTCAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020850.1-2371s21c1
Sequence:CCGGCAAGTTGGTGATAGCTTATTACTCGAGTAATAAGCTATCACCAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_020850.1-974s21c1
Sequence:CCGGGGAAGAACAGGCGTCCATAAACTCGAGTTTATGGACGCCTGTTCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020850.1-748s21c1
Sequence:CCGGAGATTGTGGACGCCAACTTTGCTCGAGCAAAGTTGGCGTCCACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020850.1-908s21c1
Sequence:CCGGCCTCGTGCATCATGGGTATTGCTCGAGCAATACCCATGATGCACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020850.1-1694s21c1
Sequence:CCGGCCGGGAGTACGGCAAGAATTTCTCGAGAAATTCTTGCCGTACTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020850.1-449s1c1
Sequence:CCGGCAAAGGAAGAGATGGTTACATCTCGAGATGTAACCATCTCTTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020850
VALIDATED
RANBP10 MISSION shRNA shRNA Plasmid DNA
RAN binding protein 10
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020850.1-782s1c1
Sequence:CCGGCCTGTTTGACATTGAGGACTACTCGAGTAGTCCTCAATGTCAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020850.1-2371s21c1
Sequence:CCGGCAAGTTGGTGATAGCTTATTACTCGAGTAATAAGCTATCACCAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_020850.1-974s21c1
Sequence:CCGGGGAAGAACAGGCGTCCATAAACTCGAGTTTATGGACGCCTGTTCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020850.1-748s21c1
Sequence:CCGGAGATTGTGGACGCCAACTTTGCTCGAGCAAAGTTGGCGTCCACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020850.1-908s21c1
Sequence:CCGGCCTCGTGCATCATGGGTATTGCTCGAGCAATACCCATGATGCACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020850.1-1694s21c1
Sequence:CCGGCCGGGAGTACGGCAAGAATTTCTCGAGAAATTCTTGCCGTACTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020850.1-449s1c1
Sequence:CCGGCAAAGGAAGAGATGGTTACATCTCGAGATGTAACCATCTCTTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020850
VALIDATED
RANBP10 MISSION shRNA Lentiviral Transduction Particles
RAN binding protein 10
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020850.1-782s1c1
Sequence:CCGGCCTGTTTGACATTGAGGACTACTCGAGTAGTCCTCAATGTCAAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020850.1-2371s21c1
Sequence:CCGGCAAGTTGGTGATAGCTTATTACTCGAGTAATAAGCTATCACCAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_020850.1-974s21c1
Sequence:CCGGGGAAGAACAGGCGTCCATAAACTCGAGTTTATGGACGCCTGTTCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020850.1-748s21c1
Sequence:CCGGAGATTGTGGACGCCAACTTTGCTCGAGCAAAGTTGGCGTCCACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020850.1-908s21c1
Sequence:CCGGCCTCGTGCATCATGGGTATTGCTCGAGCAATACCCATGATGCACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020850.1-1694s21c1
Sequence:CCGGCCGGGAGTACGGCAAGAATTTCTCGAGAAATTCTTGCCGTACTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020850.1-449s1c1
Sequence:CCGGCAAAGGAAGAGATGGTTACATCTCGAGATGTAACCATCTCTTCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)