EMAIL THIS PAGE TO A FRIEND

RANBP17

RAN binding protein 17

199 Gene Product Result for
UniProtKB ID: Q9H2T7
Gene ID:
Human(64901) Summary: The transport of protein and large RNAs through the nuclear pore complexes (NPC) is an energy-dependent and regulated process. The import of proteins with a nuclear localization signal (NLS) is accomplished by recognition of one or more clusters of basic amino acids by the importin-alpha/beta complex; see MIM 600685 and MIM 602738. The small GTPase RAN (MIM 601179) plays a key role in NLS-dependent protein import. RAN-binding protein-17 is a member of the importin-beta superfamily of nuclear transport receptors.[supplied by OMIM, Jul 2002]
Mouse(66011) RAN binding protein 17
Rat(303029) RAN binding protein 17
domestic cat(101099021) RAN binding protein 17
Horse(100070317) RAN binding protein 17
dog(479293) RAN binding protein 17
naked mole-rat(101703296) RAN binding protein 17
domestic guinea pig(100723196) RAN binding protein 17
cow(100337114) RAN binding protein 17
cow(529222) RAN binding protein 17
sheep(101104527) RAN binding protein 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022897 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023146 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023146 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023146 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022897 Rosetta Predictions human pricing
NM_001106994 Rosetta Predictions rat pricing
NM_023146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152360 predicted 672
2 SASI_Hs02_00356181 predicted 1216
3 SASI_Hs01_00152361 predicted 1130
4 SASI_Hs02_00356182 predicted 1496
5 SASI_Hs01_00152363 predicted 2658
6 SASI_Hs02_00356183 predicted 2485
7 SASI_Hs01_00152365 predicted 843
8 SASI_Hs01_00152366 predicted 1237
9 SASI_Hs01_00152367 predicted 2377
10 SASI_Hs02_00356184 predicted 1274
11 SASI_Hs01_00152359 predicted 1012
12 SASI_Hs01_00152362 predicted 2750
13 SASI_Hs01_00152364 predicted 501
14 SASI_Hs01_00152368 predicted 2785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106994 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224436 predicted 2393
2 SASI_Rn02_00224437 predicted 1036
3 SASI_Rn02_00224438 predicted 1022
4 SASI_Rn02_00224439 predicted 1579
5 SASI_Rn02_00224440 predicted 503
6 SASI_Rn02_00224441 predicted 254
7 SASI_Rn02_00224442 predicted 1507
8 SASI_Rn02_00224443 predicted 1948
9 SASI_Rn02_00224444 predicted 427
10 SASI_Rn02_00224445 predicted 2664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189514 predicted 978
2 SASI_Mm01_00189516 predicted 2311
3 SASI_Mm01_00189517 predicted 1579
4 SASI_Mm01_00189518 predicted 1025
5 SASI_Mm01_00189519 predicted 1949
6 SASI_Mm01_00189520 predicted 1507
7 SASI_Mm01_00189521 predicted 2391
8 SASI_Mm01_00189522 predicted 2881
9 SASI_Mm01_00189523 predicted 406
10 SASI_Mm02_00326874 predicted 1547
11 SASI_Mm01_00189515 predicted 1260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022897
VALIDATED
RANBP17 MISSION shRNA Bacterial Glycerol Stock
RAN binding protein 17
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182905    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022897.2-3411s1c1
Sequence:CCGGCCCTAACTTCTTATACGTCTACTCGAGTAGACGTATAAGAAGTTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022897.2-911s1c1
Sequence:CCGGCGTGCCAAGTACCTTGGTAATCTCGAGATTACCAAGGTACTTGGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_022897.2-451s21c1
Sequence:CCGGACACTGCATAATAGGAGTAATCTCGAGATTACTCCTATTATGCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022897.2-973s21c1
Sequence:CCGGTTTGTCTGATCCAGGTAATTACTCGAGTAATTACCTGGATCAGACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022897.2-544s21c1
Sequence:CCGGAGCTACCTCATTTCGTGATACCTCGAGGTATCACGAAATGAGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022897.2-878s21c1
Sequence:CCGGTCGACAAGAAGGTCCTTATTTCTCGAGAAATAAGGACCTTCTTGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022897.2-3420s21c1
Sequence:CCGGCTTATACGTCTAGCCTAATTACTCGAGTAATTAGGCTAGACGTATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022897
VALIDATED
RANBP17 MISSION shRNA shRNA Plasmid DNA
RAN binding protein 17
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182905    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022897.2-3411s1c1
Sequence:CCGGCCCTAACTTCTTATACGTCTACTCGAGTAGACGTATAAGAAGTTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022897.2-911s1c1
Sequence:CCGGCGTGCCAAGTACCTTGGTAATCTCGAGATTACCAAGGTACTTGGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_022897.2-451s21c1
Sequence:CCGGACACTGCATAATAGGAGTAATCTCGAGATTACTCCTATTATGCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022897.2-973s21c1
Sequence:CCGGTTTGTCTGATCCAGGTAATTACTCGAGTAATTACCTGGATCAGACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022897.2-544s21c1
Sequence:CCGGAGCTACCTCATTTCGTGATACCTCGAGGTATCACGAAATGAGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022897.2-878s21c1
Sequence:CCGGTCGACAAGAAGGTCCTTATTTCTCGAGAAATAAGGACCTTCTTGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022897.2-3420s21c1
Sequence:CCGGCTTATACGTCTAGCCTAATTACTCGAGTAATTAGGCTAGACGTATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022897
VALIDATED
RANBP17 MISSION shRNA Lentiviral Transduction Particles
RAN binding protein 17
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182905    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022897.2-3411s1c1
Sequence:CCGGCCCTAACTTCTTATACGTCTACTCGAGTAGACGTATAAGAAGTTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022897.2-911s1c1
Sequence:CCGGCGTGCCAAGTACCTTGGTAATCTCGAGATTACCAAGGTACTTGGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_022897.2-451s21c1
Sequence:CCGGACACTGCATAATAGGAGTAATCTCGAGATTACTCCTATTATGCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022897.2-973s21c1
Sequence:CCGGTTTGTCTGATCCAGGTAATTACTCGAGTAATTACCTGGATCAGACAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022897.2-544s21c1
Sequence:CCGGAGCTACCTCATTTCGTGATACCTCGAGGTATCACGAAATGAGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022897.2-878s21c1
Sequence:CCGGTCGACAAGAAGGTCCTTATTTCTCGAGAAATAAGGACCTTCTTGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022897.2-3420s21c1
Sequence:CCGGCTTATACGTCTAGCCTAATTACTCGAGTAATTAGGCTAGACGTATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023146
RANBP17 MISSION shRNA Bacterial Glycerol Stock
RAN binding protein 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023146.1-1925s1c1
Sequence:CCGGGCTGTGAAATTCATGCTGAAACTCGAGTTTCAGCATGAATTTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023146.1-240s1c1
Sequence:CCGGCCCGAATCAATCCTTTACCTACTCGAGTAGGTAAAGGATTGATTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023146.1-2314s1c1
Sequence:CCGGCGCATGTACTACTCCAATCTTCTCGAGAAGATTGGAGTAGTACATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023146.1-1142s1c1
Sequence:CCGGCCCAACAGTGTTCATTACTTACTCGAGTAAGTAATGAACACTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023146.1-1286s1c1
Sequence:CCGGGCCATTGTTGTGAGAGATAATCTCGAGATTATCTCTCACAACAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023146
RANBP17 MISSION shRNA shRNA Plasmid DNA
RAN binding protein 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023146.1-1925s1c1
Sequence:CCGGGCTGTGAAATTCATGCTGAAACTCGAGTTTCAGCATGAATTTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023146.1-240s1c1
Sequence:CCGGCCCGAATCAATCCTTTACCTACTCGAGTAGGTAAAGGATTGATTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023146.1-2314s1c1
Sequence:CCGGCGCATGTACTACTCCAATCTTCTCGAGAAGATTGGAGTAGTACATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023146.1-1142s1c1
Sequence:CCGGCCCAACAGTGTTCATTACTTACTCGAGTAAGTAATGAACACTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023146.1-1286s1c1
Sequence:CCGGGCCATTGTTGTGAGAGATAATCTCGAGATTATCTCTCACAACAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023146
RANBP17 MISSION shRNA Lentiviral Transduction Particles
RAN binding protein 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023146.1-1925s1c1
Sequence:CCGGGCTGTGAAATTCATGCTGAAACTCGAGTTTCAGCATGAATTTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023146.1-240s1c1
Sequence:CCGGCCCGAATCAATCCTTTACCTACTCGAGTAGGTAAAGGATTGATTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023146.1-2314s1c1
Sequence:CCGGCGCATGTACTACTCCAATCTTCTCGAGAAGATTGGAGTAGTACATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023146.1-1142s1c1
Sequence:CCGGCCCAACAGTGTTCATTACTTACTCGAGTAAGTAATGAACACTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023146.1-1286s1c1
Sequence:CCGGGCCATTGTTGTGAGAGATAATCTCGAGATTATCTCTCACAACAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)