EMAIL THIS PAGE TO A FRIEND

RANBP1

RAN binding protein 1

54 Gene Product Result for
Synonyms: HTF9A
UniProtKB ID: P43487
Gene ID:
Human(5902) Summary: This gene encodes a protein that forms a complex with Ras-related nuclear protein (Ran) and metabolizes guanoside triphosphate (GTP). This complex participates in the regulation of the cell cycle by controlling transport of proteins and nucleic acids into the nucleus. There are multiple pseudogenes for this gene on chromosomes 9, 12, 17, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(19385) RAN binding protein 1
Rat(360739) RAN binding protein 1
Thale Cress(835973) Ran-binding protein 1
dog(477563) RAN binding protein 1
domestic cat(101100924) RAN binding protein 1
Zebrafish(337046) RAN binding protein 1
chicken(416787) RAN binding protein 1
naked mole-rat(101726722) RAN binding protein 1
domestic guinea pig(100731788) RAN binding protein 1
cow(533251) RAN binding protein 1
sheep(101122630) RAN binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002882 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002882 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002882 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011239 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011239 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011239 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002882 Rosetta Predictions human pricing
NM_001108324 Rosetta Predictions rat pricing
NM_011239 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334661 predicted 517
2 SASI_Hs02_00334662 predicted 472
3 SASI_Hs02_00334663 predicted 519
4 SASI_Hs02_00334664 predicted 518
5 SASI_Hs02_00334665 predicted 427
6 SASI_Hs02_00334666 predicted 362
7 SASI_Hs02_00334667 predicted 356
8 SASI_Hs02_00334668 predicted 407
9 SASI_Hs02_00334669 predicted 367
10 SASI_Hs02_00334670 predicted 349
11 SASI_Hs01_00121506 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108324 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237539 predicted 216
2 SASI_Rn02_00237540 predicted 464
3 SASI_Rn02_00237541 predicted 353
4 SASI_Rn02_00237542 predicted 433
5 SASI_Rn02_00237543 predicted 293
6 SASI_Rn02_00237544 predicted 356
7 SASI_Rn02_00237545 predicted 349
8 SASI_Rn02_00237546 predicted 298
9 SASI_Rn02_00237547 predicted 512
10 SASI_Rn02_00237548 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171984 predicted 426
2 SASI_Mm01_00171986 predicted 341
3 SASI_Mm01_00171987 predicted 389
4 SASI_Mm01_00171988 predicted 379
5 SASI_Mm02_00320205 predicted 286
6 SASI_Mm02_00320206 predicted 204
7 SASI_Mm01_00171991 predicted 418
8 SASI_Mm01_00171992 predicted 289
9 SASI_Mm02_00320207 predicted 406
10 SASI_Mm02_00320208 predicted 454
11 SASI_Mm01_00171985 predicted 355
12 SASI_Mm01_00171989 predicted 300
13 SASI_Mm01_00171990 predicted 392
14 SASI_Mm01_00171993 predicted 421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002882
VALIDATED
RANBP1 MISSION shRNA Bacterial Glycerol Stock
RAN binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-222s1c1
Sequence:CCGGCCTCAGTTTGAGCCAATAGTTCTCGAGAACTATTGGCTCAAACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-578s1c1
Sequence:CCGGGAATGCTGAGAATGCACAGAACTCGAGTTCTGTGCATTCTCAGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002882.2-328s1c1
Sequence:CCGGCTGAGAACGATCTCCCAGAATCTCGAGATTCTGGGAGATCGTTCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-618s1c1
Sequence:CCGGGAATGCAGGAAAGAGATCGAACTCGAGTTCGATCTCTTTCCTGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-273s1c1
Sequence:CCGGGAAGAAGATGAAGAGGAACTTCTCGAGAAGTTCCTCTTCATCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-585s1c1
Sequence:CCGGGAGAATGCACAGAAATTCAAACTCGAGTTTGAATTTCTGTGCATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-233s1c1
Sequence:CCGGGCCAATAGTTTCTCTTCCTGACTCGAGTCAGGAAGAGAAACTATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-179s1c1
Sequence:CCGGCCATGATACTTCCACTGAGAACTCGAGTTCTCAGTGGAAGTATCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-190s1c1
Sequence:CCGGCCACTGAGAATACAGACGAGTCTCGAGACTCGTCTGTATTCTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002882.2-622s1c1
Sequence:CCGGGCAGGAAAGAGATCGAAGAGACTCGAGTCTCTTCGATCTCTTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002882
VALIDATED
RANBP1 MISSION shRNA shRNA Plasmid DNA
RAN binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-222s1c1
Sequence:CCGGCCTCAGTTTGAGCCAATAGTTCTCGAGAACTATTGGCTCAAACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-578s1c1
Sequence:CCGGGAATGCTGAGAATGCACAGAACTCGAGTTCTGTGCATTCTCAGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002882.2-328s1c1
Sequence:CCGGCTGAGAACGATCTCCCAGAATCTCGAGATTCTGGGAGATCGTTCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-618s1c1
Sequence:CCGGGAATGCAGGAAAGAGATCGAACTCGAGTTCGATCTCTTTCCTGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-273s1c1
Sequence:CCGGGAAGAAGATGAAGAGGAACTTCTCGAGAAGTTCCTCTTCATCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-585s1c1
Sequence:CCGGGAGAATGCACAGAAATTCAAACTCGAGTTTGAATTTCTGTGCATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-233s1c1
Sequence:CCGGGCCAATAGTTTCTCTTCCTGACTCGAGTCAGGAAGAGAAACTATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-179s1c1
Sequence:CCGGCCATGATACTTCCACTGAGAACTCGAGTTCTCAGTGGAAGTATCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-190s1c1
Sequence:CCGGCCACTGAGAATACAGACGAGTCTCGAGACTCGTCTGTATTCTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002882.2-622s1c1
Sequence:CCGGGCAGGAAAGAGATCGAAGAGACTCGAGTCTCTTCGATCTCTTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002882
VALIDATED
RANBP1 MISSION shRNA Lentiviral Transduction Particles
RAN binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-222s1c1
Sequence:CCGGCCTCAGTTTGAGCCAATAGTTCTCGAGAACTATTGGCTCAAACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-578s1c1
Sequence:CCGGGAATGCTGAGAATGCACAGAACTCGAGTTCTGTGCATTCTCAGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002882.2-328s1c1
Sequence:CCGGCTGAGAACGATCTCCCAGAATCTCGAGATTCTGGGAGATCGTTCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-618s1c1
Sequence:CCGGGAATGCAGGAAAGAGATCGAACTCGAGTTCGATCTCTTTCCTGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-273s1c1
Sequence:CCGGGAAGAAGATGAAGAGGAACTTCTCGAGAAGTTCCTCTTCATCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-585s1c1
Sequence:CCGGGAGAATGCACAGAAATTCAAACTCGAGTTTGAATTTCTGTGCATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-233s1c1
Sequence:CCGGGCCAATAGTTTCTCTTCCTGACTCGAGTCAGGAAGAGAAACTATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-179s1c1
Sequence:CCGGCCATGATACTTCCACTGAGAACTCGAGTTCTCAGTGGAAGTATCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002882.2-190s1c1
Sequence:CCGGCCACTGAGAATACAGACGAGTCTCGAGACTCGTCTGTATTCTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002882.2-622s1c1
Sequence:CCGGGCAGGAAAGAGATCGAAGAGACTCGAGTCTCTTCGATCTCTTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011239
VALIDATED
RANBP1 MISSION shRNA Bacterial Glycerol Stock
RAN binding protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011239.2-162s21c1
Sequence:CCGGCCATGATACTTCCACAGAGAACTCGAGTTCTCTGTGGAAGTATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011239.2-431s21c1
Sequence:CCGGCCAACCACTATATTACACCAACTCGAGTTGGTGTAATATAGTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011239.2-290s21c1
Sequence:CCGGCAAAGCTGTTCCGGTTTGCTTCTCGAGAAGCAAACCGGAACAGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011239.1-793s1c1
Sequence:CCGGCCTACCCTTTAAGGTTTGTTTCTCGAGAAACAAACCTTAAAGGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011239.1-167s1c1
Sequence:CCGGCCATGATACTTCCACAGAGAACTCGAGTTCTCTGTGGAAGTATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011239.1-398s1c1
Sequence:CCGGCCTTCTTATGAGGAGGGACAACTCGAGTTGTCCCTCCTCATAAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011239.2-178s21c1
Sequence:CCGGGAGAATGCAGATGAGTCCAACCTCGAGGTTGGACTCATCTGCATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011239.2-547s21c1
Sequence:CCGGGCCATCCGCTTCCTAAATGCTCTCGAGAGCATTTAGGAAGCGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011239.2-381s21c1
Sequence:CCGGAGGGACCATCCGCCTTCTTATCTCGAGATAAGAAGGCGGATGGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011239
VALIDATED
RANBP1 MISSION shRNA shRNA Plasmid DNA
RAN binding protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011239.2-162s21c1
Sequence:CCGGCCATGATACTTCCACAGAGAACTCGAGTTCTCTGTGGAAGTATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011239.2-431s21c1
Sequence:CCGGCCAACCACTATATTACACCAACTCGAGTTGGTGTAATATAGTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011239.2-290s21c1
Sequence:CCGGCAAAGCTGTTCCGGTTTGCTTCTCGAGAAGCAAACCGGAACAGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011239.1-793s1c1
Sequence:CCGGCCTACCCTTTAAGGTTTGTTTCTCGAGAAACAAACCTTAAAGGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011239.1-167s1c1
Sequence:CCGGCCATGATACTTCCACAGAGAACTCGAGTTCTCTGTGGAAGTATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011239.1-398s1c1
Sequence:CCGGCCTTCTTATGAGGAGGGACAACTCGAGTTGTCCCTCCTCATAAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011239.2-178s21c1
Sequence:CCGGGAGAATGCAGATGAGTCCAACCTCGAGGTTGGACTCATCTGCATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011239.2-547s21c1
Sequence:CCGGGCCATCCGCTTCCTAAATGCTCTCGAGAGCATTTAGGAAGCGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011239.2-381s21c1
Sequence:CCGGAGGGACCATCCGCCTTCTTATCTCGAGATAAGAAGGCGGATGGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011239
VALIDATED
RANBP1 MISSION shRNA Lentiviral Transduction Particles
RAN binding protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011239.2-162s21c1
Sequence:CCGGCCATGATACTTCCACAGAGAACTCGAGTTCTCTGTGGAAGTATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011239.2-431s21c1
Sequence:CCGGCCAACCACTATATTACACCAACTCGAGTTGGTGTAATATAGTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011239.2-290s21c1
Sequence:CCGGCAAAGCTGTTCCGGTTTGCTTCTCGAGAAGCAAACCGGAACAGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011239.1-793s1c1
Sequence:CCGGCCTACCCTTTAAGGTTTGTTTCTCGAGAAACAAACCTTAAAGGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011239.1-167s1c1
Sequence:CCGGCCATGATACTTCCACAGAGAACTCGAGTTCTCTGTGGAAGTATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011239.1-398s1c1
Sequence:CCGGCCTTCTTATGAGGAGGGACAACTCGAGTTGTCCCTCCTCATAAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011239.2-178s21c1
Sequence:CCGGGAGAATGCAGATGAGTCCAACCTCGAGGTTGGACTCATCTGCATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011239.2-547s21c1
Sequence:CCGGGCCATCCGCTTCCTAAATGCTCTCGAGAGCATTTAGGAAGCGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011239.2-381s21c1
Sequence:CCGGAGGGACCATCCGCCTTCTTATCTCGAGATAAGAAGGCGGATGGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)