EMAIL THIS PAGE TO A FRIEND

RANBP2

RAN binding protein 2

137 Gene Product Result for
Synonyms: ANE1 IIAE3 NUP358 TRP1 TRP2
UniProtKB ID: P49792, Q13074, Q15280, Q53TE2, Q59FH7
Gene ID:
Human(5903) Summary: RAN is a small GTP-binding protein of the RAS superfamily that is associated with the nuclear membrane and is thought to control a variety of cellular functions through its interactions with other proteins. This gene encodes a very large RAN-binding protein that immunolocalizes to the nuclear pore complex. The protein is a giant scaffold and mosaic cyclophilin-related nucleoporin implicated in the Ran-GTPase cycle. The encoded protein directly interacts with the E2 enzyme UBC9 and strongly enhances SUMO1 transfer from UBC9 to the SUMO1 target SP100. These findings place sumoylation at the cytoplasmic filaments of the nuclear pore complex and suggest that, for some substrates, modification and nuclear import are linked events. This gene is partially duplicated in a gene cluster that lies in a hot spot for recombination on chromosome 2q. [provided by RefSeq, Jul 2008]
Mouse(19386) RAN binding protein 2
Rat(294429) RAN binding protein 2
cow(785768) RAN binding protein 2
sheep(101116816) RAN binding protein 2
domestic guinea pig(101788077) RAN binding protein 2
naked mole-rat(101698338) RAN binding protein 2
chicken(418730) RAN binding protein 2
Horse(100060826) RAN binding protein 2
domestic cat(101094012) RAN binding protein 2
dog(474539) RAN binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011240 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011240 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011240 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006267 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU043891 MISSION® esiRNA esiRNA targeting mouse Ranbp2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006267 Rosetta Predictions human pricing
XM_001053839 Rosetta Predictions rat pricing
XM_215401 Rosetta Predictions rat pricing
NM_011240 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221992 predicted 5677
2 SASI_Hs01_00221993 predicted 8873
3 SASI_Hs01_00221994 predicted 4333
4 SASI_Hs02_00341223 predicted 8158
5 SASI_Hs01_00221995 predicted 4415
6 SASI_Hs02_00341224 predicted 3373
7 SASI_Hs01_00221996 predicted 7401
8 SASI_Hs02_00341225 predicted 3642
9 SASI_Hs01_00221998 predicted 6951
10 SASI_Hs01_00222000 predicted 4799
11 SASI_Hs01_00221997 predicted 9842
12 SASI_Hs01_00221999 predicted 6914
13 SASI_Hs01_00222001 predicted 3347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053839 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273764 predicted 9278
2 SASI_Rn02_00273765 predicted 2612
3 SASI_Rn02_00273766 predicted 4575
4 SASI_Rn02_00273767 predicted 5404
5 SASI_Rn02_00273768 predicted 6427
6 SASI_Rn02_00273769 predicted 842
7 SASI_Rn02_00273770 predicted 4340
8 SASI_Rn02_00273771 predicted 8481
9 SASI_Rn02_00273772 predicted 3008
10 SASI_Rn02_00273773 predicted 9383
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375955 predicted 9275
2 SASI_Rn02_00375956 predicted 2615
3 SASI_Rn02_00375957 predicted 4579
4 SASI_Rn02_00375958 predicted 5407
5 SASI_Rn02_00375959 predicted 6428
6 SASI_Rn02_00375960 predicted 837
7 SASI_Rn02_00375961 predicted 4341
8 SASI_Rn02_00375962 predicted 8481
9 SASI_Rn02_00375963 predicted 3008
10 SASI_Rn02_00375964 predicted 9386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011240 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320209 predicted 4375
2 SASI_Mm01_00161115 predicted 2720
3 SASI_Mm01_00161116 predicted 3385
4 SASI_Mm01_00161118 predicted 1471
5 SASI_Mm01_00161119 predicted 8361
6 SASI_Mm02_00320210 predicted 4882
7 SASI_Mm02_00320211 predicted 6293
8 SASI_Mm02_00320212 predicted 6462
9 SASI_Mm01_00161120 predicted 6736
10 SASI_Mm01_00161121 predicted 4630
11 SASI_Mm01_00161112 predicted 1618
12 SASI_Mm01_00161113 predicted 2367
13 SASI_Mm01_00161114 predicted 840
14 SASI_Mm01_00161117 predicted 4551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011240
VALIDATED
RANBP2 MISSION shRNA Bacterial Glycerol Stock
RAN binding protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011240.3-7629s21c1
Sequence:CCGGCCTGGCTATGTTAGTGAAGAACTCGAGTTCTTCACTAACATAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011240.3-3912s21c1
Sequence:CCGGGCCCTTGATTATGCAGATGAACTCGAGTTCATCTGCATAATCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011240.3-8837s21c1
Sequence:CCGGTGAACCTCTAGGACGGATAATCTCGAGATTATCCGTCCTAGAGGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011240.3-9324s21c1
Sequence:CCGGGCAGTTGAATTGATGCGTAATCTCGAGATTACGCATCAATTCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011240.3-2266s21c1
Sequence:CCGGAGACTAGGGACTACCTGATAACTCGAGTTATCAGGTAGTCCCTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011240.2-3913s1c1
Sequence:CCGGCCCTTGATTATGCAGATGAATCTCGAGATTCATCTGCATAATCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011240.2-3912s1c1
Sequence:CCGGGCCCTTGATTATGCAGATGAACTCGAGTTCATCTGCATAATCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011240.2-9324s1c1
Sequence:CCGGGCAGTTGAATTGATGCGTAATCTCGAGATTACGCATCAATTCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011240.2-7629s1c1
Sequence:CCGGCCTGGCTATGTTAGTGAAGAACTCGAGTTCTTCACTAACATAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011240.2-2769s1c1
Sequence:CCGGCCTGCATATAACTCCCAGTATCTCGAGATACTGGGAGTTATATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011240
VALIDATED
RANBP2 MISSION shRNA shRNA Plasmid DNA
RAN binding protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011240.3-7629s21c1
Sequence:CCGGCCTGGCTATGTTAGTGAAGAACTCGAGTTCTTCACTAACATAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011240.3-3912s21c1
Sequence:CCGGGCCCTTGATTATGCAGATGAACTCGAGTTCATCTGCATAATCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011240.3-8837s21c1
Sequence:CCGGTGAACCTCTAGGACGGATAATCTCGAGATTATCCGTCCTAGAGGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011240.3-9324s21c1
Sequence:CCGGGCAGTTGAATTGATGCGTAATCTCGAGATTACGCATCAATTCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011240.3-2266s21c1
Sequence:CCGGAGACTAGGGACTACCTGATAACTCGAGTTATCAGGTAGTCCCTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011240.2-3913s1c1
Sequence:CCGGCCCTTGATTATGCAGATGAATCTCGAGATTCATCTGCATAATCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011240.2-3912s1c1
Sequence:CCGGGCCCTTGATTATGCAGATGAACTCGAGTTCATCTGCATAATCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011240.2-9324s1c1
Sequence:CCGGGCAGTTGAATTGATGCGTAATCTCGAGATTACGCATCAATTCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011240.2-7629s1c1
Sequence:CCGGCCTGGCTATGTTAGTGAAGAACTCGAGTTCTTCACTAACATAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011240.2-2769s1c1
Sequence:CCGGCCTGCATATAACTCCCAGTATCTCGAGATACTGGGAGTTATATGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011240
VALIDATED
RANBP2 MISSION shRNA Lentiviral Transduction Particles
RAN binding protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011240.3-7629s21c1
Sequence:CCGGCCTGGCTATGTTAGTGAAGAACTCGAGTTCTTCACTAACATAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011240.3-3912s21c1
Sequence:CCGGGCCCTTGATTATGCAGATGAACTCGAGTTCATCTGCATAATCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011240.3-8837s21c1
Sequence:CCGGTGAACCTCTAGGACGGATAATCTCGAGATTATCCGTCCTAGAGGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011240.3-9324s21c1
Sequence:CCGGGCAGTTGAATTGATGCGTAATCTCGAGATTACGCATCAATTCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011240.3-2266s21c1
Sequence:CCGGAGACTAGGGACTACCTGATAACTCGAGTTATCAGGTAGTCCCTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011240.2-3913s1c1
Sequence:CCGGCCCTTGATTATGCAGATGAATCTCGAGATTCATCTGCATAATCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011240.2-3912s1c1
Sequence:CCGGGCCCTTGATTATGCAGATGAACTCGAGTTCATCTGCATAATCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011240.2-9324s1c1
Sequence:CCGGGCAGTTGAATTGATGCGTAATCTCGAGATTACGCATCAATTCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011240.2-7629s1c1
Sequence:CCGGCCTGGCTATGTTAGTGAAGAACTCGAGTTCTTCACTAACATAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011240.2-2769s1c1
Sequence:CCGGCCTGCATATAACTCCCAGTATCTCGAGATACTGGGAGTTATATGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006267
VALIDATED
RANBP2 MISSION shRNA Bacterial Glycerol Stock
RAN binding protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006267.4-5008s21c1
Sequence:CCGGGCTTGTCAGAATCCAGGTAAACTCGAGTTTACCTGGATTCTGACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006267.4-3502s21c1
Sequence:CCGGCGGCGAAGTGATGATATGTTTCTCGAGAAACATATCATCACTTCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006267.4-4820s21c1
Sequence:CCGGCTTGTCAGAATCCGGATAAACCTCGAGGTTTATCCGGATTCTGACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006267.4-3153s21c1
Sequence:CCGGCATGCCGGGTGAAGGATTAAGCTCGAGCTTAATCCTTCACCCGGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006267.4-10026s21c1
Sequence:CCGGATGTACTCCTGACGTATTAAACTCGAGTTTAATACGTCAGGAGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006267.x-3502s1c1
Sequence:CCGGCGGCGAAGTGATGATATGTTTCTCGAGAAACATATCATCACTTCGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006267.x-8794s1c1
Sequence:CCGGGCCGGTAAAGTTGGTGAAGATCTCGAGATCTTCACCAACTTTACCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006267.x-9967s1c1
Sequence:CCGGCCTTGCATGGTGTGAAATAAACTCGAGTTTATTTCACACCATGCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006267.x-8531s1c1
Sequence:CCGGCCATTAGTTCACCATCTGTTTCTCGAGAAACAGATGGTGAACTAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006267.x-5008s1c1
Sequence:CCGGGCTTGTCAGAATCCAGGTAAACTCGAGTTTACCTGGATTCTGACAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006267
VALIDATED
RANBP2 MISSION shRNA shRNA Plasmid DNA
RAN binding protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006267.4-5008s21c1
Sequence:CCGGGCTTGTCAGAATCCAGGTAAACTCGAGTTTACCTGGATTCTGACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006267.4-3502s21c1
Sequence:CCGGCGGCGAAGTGATGATATGTTTCTCGAGAAACATATCATCACTTCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006267.4-4820s21c1
Sequence:CCGGCTTGTCAGAATCCGGATAAACCTCGAGGTTTATCCGGATTCTGACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006267.4-3153s21c1
Sequence:CCGGCATGCCGGGTGAAGGATTAAGCTCGAGCTTAATCCTTCACCCGGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006267.4-10026s21c1
Sequence:CCGGATGTACTCCTGACGTATTAAACTCGAGTTTAATACGTCAGGAGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006267.x-3502s1c1
Sequence:CCGGCGGCGAAGTGATGATATGTTTCTCGAGAAACATATCATCACTTCGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006267.x-8794s1c1
Sequence:CCGGGCCGGTAAAGTTGGTGAAGATCTCGAGATCTTCACCAACTTTACCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006267.x-9967s1c1
Sequence:CCGGCCTTGCATGGTGTGAAATAAACTCGAGTTTATTTCACACCATGCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006267.x-8531s1c1
Sequence:CCGGCCATTAGTTCACCATCTGTTTCTCGAGAAACAGATGGTGAACTAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006267.x-5008s1c1
Sequence:CCGGGCTTGTCAGAATCCAGGTAAACTCGAGTTTACCTGGATTCTGACAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006267
VALIDATED
RANBP2 MISSION shRNA Lentiviral Transduction Particles
RAN binding protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006267.4-5008s21c1
Sequence:CCGGGCTTGTCAGAATCCAGGTAAACTCGAGTTTACCTGGATTCTGACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006267.4-3502s21c1
Sequence:CCGGCGGCGAAGTGATGATATGTTTCTCGAGAAACATATCATCACTTCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006267.4-4820s21c1
Sequence:CCGGCTTGTCAGAATCCGGATAAACCTCGAGGTTTATCCGGATTCTGACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006267.4-3153s21c1
Sequence:CCGGCATGCCGGGTGAAGGATTAAGCTCGAGCTTAATCCTTCACCCGGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006267.4-10026s21c1
Sequence:CCGGATGTACTCCTGACGTATTAAACTCGAGTTTAATACGTCAGGAGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006267.x-3502s1c1
Sequence:CCGGCGGCGAAGTGATGATATGTTTCTCGAGAAACATATCATCACTTCGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006267.x-8794s1c1
Sequence:CCGGGCCGGTAAAGTTGGTGAAGATCTCGAGATCTTCACCAACTTTACCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006267.x-9967s1c1
Sequence:CCGGCCTTGCATGGTGTGAAATAAACTCGAGTTTATTTCACACCATGCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006267.x-8531s1c1
Sequence:CCGGCCATTAGTTCACCATCTGTTTCTCGAGAAACAGATGGTGAACTAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006267.x-5008s1c1
Sequence:CCGGGCTTGTCAGAATCCAGGTAAACTCGAGTTTACCTGGATTCTGACAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)