EMAIL THIS PAGE TO A FRIEND

RANBP3

RAN binding protein 3

102 Gene Product Result for
Gene ID:
Human(8498) Summary: This gene encodes a protein with a RanBD1 domain that is found in both the nucleus and cytoplasm. This protein plays a role in nuclear export as part of a heteromeric complex. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(71810) RAN binding protein 3
Rat(501281) RAN binding protein 3
fruit fly(42804) Ran binding protein 3
domestic cat(101094824) RAN binding protein 3
dog(476734) RAN binding protein 3
chicken(420058) RAN binding protein 3
Zebrafish(394115) RAN binding protein 3
naked mole-rat(101706600) RAN binding protein 3
Domestic Rabbit(100348546) RAN binding protein 3
domestic guinea pig(100723681) RAN binding protein 3
cow(508641) RAN binding protein 3
sheep(101107519) RAN binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101944 Anti-RANBP3 antibody produced in rabbit affinity isolated antibody human, rabbit, guinea pig
western blot pricing
HPA043375 Anti-RANBP3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
HPA043389 Anti-RANBP3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
WH0008498M1 Monoclonal Anti-RANBP3 antibody produced in mouse clone 2E10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
PLA0193 Rabbit anti-RanBP3 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. chicken, mouse, primate, horse, guinea pig, bovine, rhesus monkey, human, toad, toad, rabbit, dog
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027933 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027933 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027933 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003624 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003624 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003624 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076161 MISSION® esiRNA esiRNA human RANBP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003624 Rosetta Predictions human pricing
NM_007320 Rosetta Predictions human pricing
NM_007322 Rosetta Predictions human pricing
XM_001056647 Rosetta Predictions rat pricing
XM_576696 Rosetta Predictions rat pricing
NM_027933 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176010 predicted 1405
2 SASI_Hs01_00176011 predicted 1303
3 SASI_Hs01_00176012 predicted 1352
4 SASI_Hs01_00176013 predicted 1481
5 SASI_Hs01_00176014 predicted 1685
6 SASI_Hs01_00176015 predicted 1480
7 SASI_Hs01_00176016 predicted 1352
8 SASI_Hs01_00176017 predicted 1419
9 SASI_Hs01_00176018 predicted 1416
10 SASI_Hs01_00176019 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176450 predicted 1216
2 SASI_Hs01_00176451 predicted 1116
3 SASI_Hs01_00176452 predicted 1161
4 SASI_Hs01_00176453 predicted 1298
5 SASI_Hs01_00176454 predicted 1499
6 SASI_Hs01_00176455 predicted 1293
7 SASI_Hs01_00176456 predicted 1160
8 SASI_Hs01_00176457 predicted 1228
9 SASI_Hs01_00176458 predicted 1228
10 SASI_Hs01_00176459 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122678 predicted 1409
2 SASI_Hs01_00122679 predicted 1307
3 SASI_Hs01_00122680 predicted 1362
4 SASI_Hs01_00122681 predicted 1491
5 SASI_Hs01_00122682 predicted 1690
6 SASI_Hs01_00122683 predicted 1479
7 SASI_Hs01_00122684 predicted 1363
8 SASI_Hs01_00122685 predicted 1427
9 SASI_Hs01_00122686 predicted 1424
10 SASI_Hs01_00122687 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283941 predicted 205
2 SASI_Rn02_00283942 predicted 256
3 SASI_Rn02_00283943 predicted 1634
4 SASI_Rn02_00283944 predicted 1078
5 SASI_Rn02_00283945 predicted 1074
6 SASI_Rn02_00283946 predicted 456
7 SASI_Rn02_00283947 predicted 648
8 SASI_Rn02_00283948 predicted 552
9 SASI_Rn02_00283949 predicted 865
10 SASI_Rn02_00283950 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405713 predicted 208
2 SASI_Rn02_00405714 predicted 252
3 SASI_Rn02_00405715 predicted 1638
4 SASI_Rn02_00405716 predicted 1076
5 SASI_Rn02_00405717 predicted 1072
6 SASI_Rn02_00405718 predicted 461
7 SASI_Rn02_00405719 predicted 644
8 SASI_Rn02_00405720 predicted 553
9 SASI_Rn02_00405721 predicted 867
10 SASI_Rn02_00405722 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118034 predicted 936
2 SASI_Mm01_00118035 predicted 1096
3 SASI_Mm01_00118036 predicted 1296
4 SASI_Mm01_00118037 predicted 715
5 SASI_Mm01_00118038 predicted 787
6 SASI_Mm01_00118039 predicted 708
7 SASI_Mm01_00118040 predicted 1117
8 SASI_Mm01_00118041 predicted 775
9 SASI_Mm01_00118042 predicted 681
10 SASI_Mm01_00118043 predicted 1174
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027933
VALIDATED
RANBP3 MISSION shRNA Bacterial Glycerol Stock
RAN binding protein 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027933.1-1196s1c1
Sequence:CCGGCAGATGGATAAGGCCAGTGAACTCGAGTTCACTGGCCTTATCCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194506    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027933.1-1799s1c1
Sequence:CCGGGCTCAGCATTCTGTTGAGTAACTCGAGTTACTCAACAGAATGCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027933.1-607s1c1
Sequence:CCGGGAGAGACAGAGTGAAGTTAATCTCGAGATTAACTTCACTCTGTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027933.1-146s1c1
Sequence:CCGGGAAGATTCTGACCATGAGGATCTCGAGATCCTCATGGTCAGAATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027933.1-749s1c1
Sequence:CCGGGCTGACAACTCCACCAAGTTTCTCGAGAAACTTGGTGGAGTTGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027933.1-809s1c1
Sequence:CCGGCCAAAGCTGAATGAAGCCAATCTCGAGATTGGCTTCATTCAGCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027933.2-706s21c1
Sequence:CCGGGAGAGACAGAGTGAAGTTAATCTCGAGATTAACTTCACTCTGTCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027933.2-1765s21c1
Sequence:CCGGGGACTCAGACCTCATCATATTCTCGAGAATATGATGAGGTCTGAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027933.2-848s21c1
Sequence:CCGGGCTGACAACTCCACCAAGTTTCTCGAGAAACTTGGTGGAGTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027933.2-245s21c1
Sequence:CCGGGAAGATTCTGACCATGAGGATCTCGAGATCCTCATGGTCAGAATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027933
VALIDATED
RANBP3 MISSION shRNA shRNA Plasmid DNA
RAN binding protein 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027933.1-1196s1c1
Sequence:CCGGCAGATGGATAAGGCCAGTGAACTCGAGTTCACTGGCCTTATCCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194506    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027933.1-1799s1c1
Sequence:CCGGGCTCAGCATTCTGTTGAGTAACTCGAGTTACTCAACAGAATGCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027933.1-607s1c1
Sequence:CCGGGAGAGACAGAGTGAAGTTAATCTCGAGATTAACTTCACTCTGTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027933.1-146s1c1
Sequence:CCGGGAAGATTCTGACCATGAGGATCTCGAGATCCTCATGGTCAGAATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027933.1-749s1c1
Sequence:CCGGGCTGACAACTCCACCAAGTTTCTCGAGAAACTTGGTGGAGTTGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027933.1-809s1c1
Sequence:CCGGCCAAAGCTGAATGAAGCCAATCTCGAGATTGGCTTCATTCAGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027933.2-706s21c1
Sequence:CCGGGAGAGACAGAGTGAAGTTAATCTCGAGATTAACTTCACTCTGTCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027933.2-1765s21c1
Sequence:CCGGGGACTCAGACCTCATCATATTCTCGAGAATATGATGAGGTCTGAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027933.2-848s21c1
Sequence:CCGGGCTGACAACTCCACCAAGTTTCTCGAGAAACTTGGTGGAGTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027933.2-245s21c1
Sequence:CCGGGAAGATTCTGACCATGAGGATCTCGAGATCCTCATGGTCAGAATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027933
VALIDATED
RANBP3 MISSION shRNA Lentiviral Transduction Particles
RAN binding protein 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027933.1-1196s1c1
Sequence:CCGGCAGATGGATAAGGCCAGTGAACTCGAGTTCACTGGCCTTATCCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194506    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027933.1-1799s1c1
Sequence:CCGGGCTCAGCATTCTGTTGAGTAACTCGAGTTACTCAACAGAATGCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027933.1-607s1c1
Sequence:CCGGGAGAGACAGAGTGAAGTTAATCTCGAGATTAACTTCACTCTGTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027933.1-146s1c1
Sequence:CCGGGAAGATTCTGACCATGAGGATCTCGAGATCCTCATGGTCAGAATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027933.1-749s1c1
Sequence:CCGGGCTGACAACTCCACCAAGTTTCTCGAGAAACTTGGTGGAGTTGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027933.1-809s1c1
Sequence:CCGGCCAAAGCTGAATGAAGCCAATCTCGAGATTGGCTTCATTCAGCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027933.2-706s21c1
Sequence:CCGGGAGAGACAGAGTGAAGTTAATCTCGAGATTAACTTCACTCTGTCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027933.2-1765s21c1
Sequence:CCGGGGACTCAGACCTCATCATATTCTCGAGAATATGATGAGGTCTGAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027933.2-848s21c1
Sequence:CCGGGCTGACAACTCCACCAAGTTTCTCGAGAAACTTGGTGGAGTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027933.2-245s21c1
Sequence:CCGGGAAGATTCTGACCATGAGGATCTCGAGATCCTCATGGTCAGAATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003624
VALIDATED
RANBP3 MISSION shRNA Bacterial Glycerol Stock
RAN binding protein 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003624.1-2711s1c1
Sequence:CCGGCCTCACCAAATCTTGGTGGAACTCGAGTTCCACCAAGATTTGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003624.1-62s1c1
Sequence:CCGGGCCCGTCTTTGTGTTTCAGAACTCGAGTTCTGAAACACAAAGACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003624.1-906s1c1
Sequence:CCGGCAGTATATCAGTTCCAGTTTACTCGAGTAAACTGGAACTGATATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003624.1-1147s1c1
Sequence:CCGGCGCGGAAGTGTTTGTTGGAAACTCGAGTTTCCAACAAACACTTCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003624.1-905s1c1
Sequence:CCGGCCAGTATATCAGTTCCAGTTTCTCGAGAAACTGGAACTGATATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003624.2-2166s21c1
Sequence:CCGGTGAATTGAAATGGCACATTAACTCGAGTTAATGTGCCATTTCAATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003624.2-1045s21c1
Sequence:CCGGACGAAGCCGACATGGAGAATGCTCGAGCATTCTCCATGTCGGCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003624.2-269s21c1
Sequence:CCGGGCCCGTCTTTGTGTTTCAGAACTCGAGTTCTGAAACACAAAGACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003624.2-2104s21c1
Sequence:CCGGGACACGAGACCTCATCATATTCTCGAGAATATGATGAGGTCTCGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003624.2-1014s21c1
Sequence:CCGGGACAGAGTTAAGCTGATAAATCTCGAGATTTATCAGCTTAACTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003624.2-1354s21c1
Sequence:CCGGCGCGGAAGTGTTTGTTGGAAACTCGAGTTTCCAACAAACACTTCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003624
VALIDATED
RANBP3 MISSION shRNA shRNA Plasmid DNA
RAN binding protein 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003624.1-2711s1c1
Sequence:CCGGCCTCACCAAATCTTGGTGGAACTCGAGTTCCACCAAGATTTGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003624.1-62s1c1
Sequence:CCGGGCCCGTCTTTGTGTTTCAGAACTCGAGTTCTGAAACACAAAGACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003624.1-906s1c1
Sequence:CCGGCAGTATATCAGTTCCAGTTTACTCGAGTAAACTGGAACTGATATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003624.1-1147s1c1
Sequence:CCGGCGCGGAAGTGTTTGTTGGAAACTCGAGTTTCCAACAAACACTTCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003624.1-905s1c1
Sequence:CCGGCCAGTATATCAGTTCCAGTTTCTCGAGAAACTGGAACTGATATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003624.2-2166s21c1
Sequence:CCGGTGAATTGAAATGGCACATTAACTCGAGTTAATGTGCCATTTCAATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003624.2-1045s21c1
Sequence:CCGGACGAAGCCGACATGGAGAATGCTCGAGCATTCTCCATGTCGGCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003624.2-269s21c1
Sequence:CCGGGCCCGTCTTTGTGTTTCAGAACTCGAGTTCTGAAACACAAAGACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003624.2-2104s21c1
Sequence:CCGGGACACGAGACCTCATCATATTCTCGAGAATATGATGAGGTCTCGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003624.2-1014s21c1
Sequence:CCGGGACAGAGTTAAGCTGATAAATCTCGAGATTTATCAGCTTAACTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003624.2-1354s21c1
Sequence:CCGGCGCGGAAGTGTTTGTTGGAAACTCGAGTTTCCAACAAACACTTCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003624
VALIDATED
RANBP3 MISSION shRNA Lentiviral Transduction Particles
RAN binding protein 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073003    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003624.1-2711s1c1
Sequence:CCGGCCTCACCAAATCTTGGTGGAACTCGAGTTCCACCAAGATTTGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003624.1-62s1c1
Sequence:CCGGGCCCGTCTTTGTGTTTCAGAACTCGAGTTCTGAAACACAAAGACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003624.1-906s1c1
Sequence:CCGGCAGTATATCAGTTCCAGTTTACTCGAGTAAACTGGAACTGATATACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003624.1-1147s1c1
Sequence:CCGGCGCGGAAGTGTTTGTTGGAAACTCGAGTTTCCAACAAACACTTCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003624.1-905s1c1
Sequence:CCGGCCAGTATATCAGTTCCAGTTTCTCGAGAAACTGGAACTGATATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003624.2-2166s21c1
Sequence:CCGGTGAATTGAAATGGCACATTAACTCGAGTTAATGTGCCATTTCAATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003624.2-1045s21c1
Sequence:CCGGACGAAGCCGACATGGAGAATGCTCGAGCATTCTCCATGTCGGCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003624.2-269s21c1
Sequence:CCGGGCCCGTCTTTGTGTTTCAGAACTCGAGTTCTGAAACACAAAGACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003624.2-2104s21c1
Sequence:CCGGGACACGAGACCTCATCATATTCTCGAGAATATGATGAGGTCTCGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_003624.2-1014s21c1
Sequence:CCGGGACAGAGTTAAGCTGATAAATCTCGAGATTTATCAGCTTAACTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_003624.2-1354s21c1
Sequence:CCGGCGCGGAAGTGTTTGTTGGAAACTCGAGTTTCCAACAAACACTTCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)