EMAIL THIS PAGE TO A FRIEND

RANBP3L

RAN binding protein 3-like

100 Gene Product Result for
UniProtKB ID: Q86VV4, B7Z866, E9PGP9, Q96LK2
Gene ID:
Mouse(223332) RAN binding protein 3-like
Rat(294789) RAN binding protein 3-like
cow(100296398) RAN binding protein 3-like
sheep(101109211) RAN binding protein 3-like
domestic guinea pig(100720430) RAN binding protein 3-like
naked mole-rat(101704804) RAN binding protein 3-like
chicken(770629) RAN binding protein 3-like
dog(489227) RAN binding protein 3-like
domestic cat(101097208) RAN binding protein 3-like
Horse(100067588) RAN binding protein 3-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198024 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198024 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198024 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145000 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145000 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145000 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054221 MISSION® esiRNA esiRNA human RANBP3L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145000 Rosetta Predictions human pricing
XM_001057097 Rosetta Predictions rat pricing
XM_215498 Rosetta Predictions rat pricing
NM_198024 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182082 predicted 1214
2 SASI_Hs02_00364834 predicted 1949
3 SASI_Hs02_00364835 predicted 1607
4 SASI_Hs01_00182084 predicted 922
5 SASI_Hs01_00182085 predicted 971
6 SASI_Hs01_00182086 predicted 769
7 SASI_Hs01_00182087 predicted 1364
8 SASI_Hs01_00182088 predicted 1834
9 SASI_Hs02_00364836 predicted 828
10 SASI_Hs01_00182089 predicted 1499
11 SASI_Hs01_00182083 predicted 1704
12 SASI_Hs01_00182090 predicted 1775
13 SASI_Hs01_00182091 predicted 1544
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285399 predicted 1409
2 SASI_Rn02_00285400 predicted 1400
3 SASI_Rn02_00285401 predicted 796
4 SASI_Rn02_00285402 predicted 1375
5 SASI_Rn02_00285403 predicted 1710
6 SASI_Rn02_00285404 predicted 675
7 SASI_Rn02_00285405 predicted 1199
8 SASI_Rn02_00285406 predicted 589
9 SASI_Rn02_00285407 predicted 324
10 SASI_Rn02_00285408 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376045 predicted 1183
2 SASI_Rn02_00376046 predicted 1183
3 SASI_Rn02_00376047 predicted 571
4 SASI_Rn02_00376048 predicted 1156
5 SASI_Rn02_00376049 predicted 1485
6 SASI_Rn02_00376050 predicted 1255
7 SASI_Rn02_00376051 predicted 451
8 SASI_Rn02_00376052 predicted 975
9 SASI_Rn02_00376053 predicted 365
10 SASI_Rn02_00376054 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198024 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350748 predicted 336
2 SASI_Mm02_00350749 predicted 1810
3 SASI_Mm02_00350750 predicted 870
4 SASI_Mm02_00350751 predicted 1789
5 SASI_Mm02_00350752 predicted 489
6 SASI_Mm02_00350753 predicted 694
7 SASI_Mm02_00350754 predicted 1764
8 SASI_Mm02_00350755 predicted 522
9 SASI_Mm02_00350756 predicted 399
10 SASI_Mm02_00350757 predicted 803
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198024
RANBP3L MISSION shRNA Bacterial Glycerol Stock
RAN binding protein 3-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198024.1-407s1c1
Sequence:CCGGGTCATTGCTCAGCCAATATTTCTCGAGAAATATTGGCTGAGCAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198024.1-1317s1c1
Sequence:CCGGCCACAGAATCCTGGAGTGAAACTCGAGTTTCACTCCAGGATTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198024.1-2867s1c1
Sequence:CCGGGCCTCCATACAACAGAAGTATCTCGAGATACTTCTGTTGTATGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198024.1-2777s1c1
Sequence:CCGGCCTGAGACTTTACAAACTGTTCTCGAGAACAGTTTGTAAAGTCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198024.1-820s1c1
Sequence:CCGGCGGTGCATTGAAATCCTACAACTCGAGTTGTAGGATTTCAATGCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198024.1-870s1c1
Sequence:CCGGCTGAAGTTGGAAGTTCCTCTACTCGAGTAGAGGAACTTCCAACTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198024.1-1505s1c1
Sequence:CCGGGCGACTGATTTAGAAGACGATCTCGAGATCGTCTTCTAAATCAGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198024.1-1495s1c1
Sequence:CCGGGCGAATAACTGCGACTGATTTCTCGAGAAATCAGTCGCAGTTATTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198024
RANBP3L MISSION shRNA shRNA Plasmid DNA
RAN binding protein 3-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198024.1-407s1c1
Sequence:CCGGGTCATTGCTCAGCCAATATTTCTCGAGAAATATTGGCTGAGCAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198024.1-1317s1c1
Sequence:CCGGCCACAGAATCCTGGAGTGAAACTCGAGTTTCACTCCAGGATTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198024.1-2867s1c1
Sequence:CCGGGCCTCCATACAACAGAAGTATCTCGAGATACTTCTGTTGTATGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198024.1-2777s1c1
Sequence:CCGGCCTGAGACTTTACAAACTGTTCTCGAGAACAGTTTGTAAAGTCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198024.1-820s1c1
Sequence:CCGGCGGTGCATTGAAATCCTACAACTCGAGTTGTAGGATTTCAATGCACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198024.1-870s1c1
Sequence:CCGGCTGAAGTTGGAAGTTCCTCTACTCGAGTAGAGGAACTTCCAACTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198024.1-1505s1c1
Sequence:CCGGGCGACTGATTTAGAAGACGATCTCGAGATCGTCTTCTAAATCAGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198024.1-1495s1c1
Sequence:CCGGGCGAATAACTGCGACTGATTTCTCGAGAAATCAGTCGCAGTTATTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198024
RANBP3L MISSION shRNA Lentiviral Transduction Particles
RAN binding protein 3-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198024.1-407s1c1
Sequence:CCGGGTCATTGCTCAGCCAATATTTCTCGAGAAATATTGGCTGAGCAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198024.1-1317s1c1
Sequence:CCGGCCACAGAATCCTGGAGTGAAACTCGAGTTTCACTCCAGGATTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198024.1-2867s1c1
Sequence:CCGGGCCTCCATACAACAGAAGTATCTCGAGATACTTCTGTTGTATGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198024.1-2777s1c1
Sequence:CCGGCCTGAGACTTTACAAACTGTTCTCGAGAACAGTTTGTAAAGTCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198024.1-820s1c1
Sequence:CCGGCGGTGCATTGAAATCCTACAACTCGAGTTGTAGGATTTCAATGCACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198024.1-870s1c1
Sequence:CCGGCTGAAGTTGGAAGTTCCTCTACTCGAGTAGAGGAACTTCCAACTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198024.1-1505s1c1
Sequence:CCGGGCGACTGATTTAGAAGACGATCTCGAGATCGTCTTCTAAATCAGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198024.1-1495s1c1
Sequence:CCGGGCGAATAACTGCGACTGATTTCTCGAGAAATCAGTCGCAGTTATTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145000
RANBP3L MISSION shRNA Bacterial Glycerol Stock
RAN binding protein 3-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145000.2-1693s1c1
Sequence:CCGGCATCATCGTCTTGTTGCACTTCTCGAGAAGTGCAACAAGACGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145000.2-1057s1c1
Sequence:CCGGGCAACATCAGTAGGATGTCAACTCGAGTTGACATCCTACTGATGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145000.2-1758s1c1
Sequence:CCGGGTCAGAAACAGCCCAACAATTCTCGAGAATTGTTGGGCTGTTTCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145000.2-1213s1c1
Sequence:CCGGCCATTCAAATCCATTCCGAAACTCGAGTTTCGGAATGGATTTGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145000.2-1947s1c1
Sequence:CCGGCCACCCTAACTAATGAGAAGACTCGAGTCTTCTCATTAGTTAGGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145000.2-668s1c1
Sequence:CCGGCAGAACCAGAATGTAATGGTTCTCGAGAACCATTACATTCTGGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145000.2-1687s1c1
Sequence:CCGGGCAATACATCATCGTCTTGTTCTCGAGAACAAGACGATGATGTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145000.2-695s1c1
Sequence:CCGGGAAAGCGTGTACGGTCTTCATCTCGAGATGAAGACCGTACACGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145000
RANBP3L MISSION shRNA shRNA Plasmid DNA
RAN binding protein 3-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145000.2-1693s1c1
Sequence:CCGGCATCATCGTCTTGTTGCACTTCTCGAGAAGTGCAACAAGACGATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145000.2-1057s1c1
Sequence:CCGGGCAACATCAGTAGGATGTCAACTCGAGTTGACATCCTACTGATGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145000.2-1758s1c1
Sequence:CCGGGTCAGAAACAGCCCAACAATTCTCGAGAATTGTTGGGCTGTTTCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145000.2-1213s1c1
Sequence:CCGGCCATTCAAATCCATTCCGAAACTCGAGTTTCGGAATGGATTTGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145000.2-1947s1c1
Sequence:CCGGCCACCCTAACTAATGAGAAGACTCGAGTCTTCTCATTAGTTAGGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145000.2-668s1c1
Sequence:CCGGCAGAACCAGAATGTAATGGTTCTCGAGAACCATTACATTCTGGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145000.2-1687s1c1
Sequence:CCGGGCAATACATCATCGTCTTGTTCTCGAGAACAAGACGATGATGTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145000.2-695s1c1
Sequence:CCGGGAAAGCGTGTACGGTCTTCATCTCGAGATGAAGACCGTACACGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145000
RANBP3L MISSION shRNA Lentiviral Transduction Particles
RAN binding protein 3-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145000.2-1693s1c1
Sequence:CCGGCATCATCGTCTTGTTGCACTTCTCGAGAAGTGCAACAAGACGATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145000.2-1057s1c1
Sequence:CCGGGCAACATCAGTAGGATGTCAACTCGAGTTGACATCCTACTGATGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145000.2-1758s1c1
Sequence:CCGGGTCAGAAACAGCCCAACAATTCTCGAGAATTGTTGGGCTGTTTCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145000.2-1213s1c1
Sequence:CCGGCCATTCAAATCCATTCCGAAACTCGAGTTTCGGAATGGATTTGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145000.2-1947s1c1
Sequence:CCGGCCACCCTAACTAATGAGAAGACTCGAGTCTTCTCATTAGTTAGGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145000.2-668s1c1
Sequence:CCGGCAGAACCAGAATGTAATGGTTCTCGAGAACCATTACATTCTGGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145000.2-1687s1c1
Sequence:CCGGGCAATACATCATCGTCTTGTTCTCGAGAACAAGACGATGATGTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145000.2-695s1c1
Sequence:CCGGGAAAGCGTGTACGGTCTTCATCTCGAGATGAAGACCGTACACGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)