EMAIL THIS PAGE TO A FRIEND

RAP1B

RAP1B, member of RAS oncogene family

78 Gene Product Result for
Synonyms: K-REV RAL1B
Gene ID:
Human(5908) Summary: This gene encodes a member of the RAS-like small GTP-binding protein superfamily. Members of this family regulate multiple cellular processes including cell adhesion and growth and differentiation. This protein localizes to cellular membranes and has been shown to regulate integrin-mediated cell signaling. This protein also plays a role in regulating outside-in signaling in platelets. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 5, 6 and 9. [provided by RefSeq, Oct 2011]
Mouse(215449) RAS related protein 1b
Rat(171337) RAP1B, member of RAS oncogene family
Zebrafish(321107) RAS related protein 1b
chicken(417840) RAP1B, member of RAS oncogene family
Horse(100052025) RAP1B, member of RAS oncogene family
domestic cat(101095993) RAP1B, member of RAS oncogene family
dog(608981) RAP1B, member of RAS oncogene family
cow(327708) RAP1B, member of RAS oncogene family
sheep(101106317) RAP1B, member of RAS oncogene family
domestic guinea pig(100734094) RAP1B, member of RAS oncogene family
naked mole-rat(101726671) RAP1B, member of RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015646 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024457 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024457 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024457 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010942 Rosetta Predictions human pricing
NM_015646 siRNAs that have been validated in the lab human pricing
NM_134346 Rosetta Predictions rat pricing
NM_024457 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305936 predicted 782
2 SASI_Hs02_00305937 predicted 610
3 SASI_Hs02_00305938 predicted 461
4 SASI_Hs02_00305939 predicted 726
5 SASI_Hs02_00305940 predicted 460
6 SASI_Hs02_00305941 predicted 895
7 SASI_Hs02_00305942 predicted 743
8 SASI_Hs02_00305943 predicted 866
9 SASI_Hs02_00305944 predicted 393
10 SASI_Hs02_00305945 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015646 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218701 validated 798
2 SASI_Hs01_00218702 predicted 617
3 SASI_Hs01_00218703 predicted 474
4 SASI_Hs01_00218705 predicted 739
5 SASI_Hs02_00348251 predicted 469
6 SASI_Hs01_00218706 predicted 901
7 SASI_Hs01_00218708 predicted 751
8 SASI_Hs01_00218710 predicted 876
9 SASI_Hs02_00348252 predicted 401
10 SASI_Hs02_00348253 predicted 881
11 SASI_Hs01_00218704 predicted 533
12 SASI_Hs01_00218707 predicted 828
13 SASI_Hs01_00218709 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267895 predicted 325
2 SASI_Rn02_00267896 predicted 287
3 SASI_Rn01_00114092 predicted 286
4 SASI_Rn02_00267897 predicted 306
5 SASI_Rn02_00267898 predicted 308
6 SASI_Rn02_00267899 predicted 287
7 SASI_Rn02_00267900 predicted 286
8 SASI_Rn02_00267901 predicted 217
9 SASI_Rn02_00267902 predicted 256
10 SASI_Rn02_00267903 predicted 215
11 SASI_Rn01_00114089 predicted 697
12 SASI_Rn01_00114090 predicted 478
13 SASI_Rn01_00114091 predicted 735
14 SASI_Rn01_00114093 predicted 764
15 SASI_Rn01_00114094 predicted 680
16 SASI_Rn01_00114095 predicted 428
17 SASI_Rn01_00114096 predicted 330
18 SASI_Rn01_00114097 predicted 783
19 SASI_Rn01_00114098 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024457 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164716 predicted 437
2 SASI_Mm01_00164717 predicted 470
3 SASI_Mm01_00164719 predicted 752
4 SASI_Mm02_00327808 predicted 425
5 SASI_Mm01_00164720 predicted 479
6 SASI_Mm01_00164721 predicted 822
7 SASI_Mm02_00327809 predicted 446
8 SASI_Mm02_00327810 predicted 465
9 SASI_Mm02_00327811 predicted 535
10 SASI_Mm02_00327812 predicted 425
11 SASI_Mm01_00164715 predicted 557
12 SASI_Mm01_00164718 predicted 586
13 SASI_Mm01_00164722 predicted 553
14 SASI_Mm01_00164723 predicted 599
15 SASI_Mm01_00164724 predicted 535
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015646
VALIDATED
RAP1B MISSION shRNA Bacterial Glycerol Stock
RAP1B, member of RAS oncogene family
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015646.4-584s21c1
Sequence:CCGGTAGGGAAGGAACAAGGTCAAACTCGAGTTTGACCTTGTTCCTTCCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015646.4-745s21c1
Sequence:CCGGTCATGTCAGCTGCTTTAATATCTCGAGATATTAAAGCAGCTGACATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015646.4-616s21c1
Sequence:CCGGCAATGGAACAACTGTGCATTCCTCGAGGAATGCACAGTTGTTCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015646.4-893s21c1
Sequence:CCGGGGCGGATGAAAGCTACTATATCTCGAGATATAGTAGCTTTCATCCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015646.3-463s1c1
Sequence:CCGGCCAATGATTCTTGTTGGTAATCTCGAGATTACCAACAAGAATCATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015646.3-618s1c1
Sequence:CCGGAGTGCGGCAAATTAACAGAAACTCGAGTTTCTGTTAATTTGCCGCACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015646.3-234s1c1
Sequence:CCGGTCCTACGATAGAAGATTCTTACTCGAGTAAGAATCTTCTATCGTAGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015646.3-425s1c1
Sequence:CCGGGAGAACAGATTCTTCGAGTTACTCGAGTAACTCGAAGAATCTGTTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015646.3-277s1c1
Sequence:CCGGGCACAACAGTGTATGCTTGAACTCGAGTTCAAGCATACACTGTTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015646
VALIDATED
RAP1B MISSION shRNA shRNA Plasmid DNA
RAP1B, member of RAS oncogene family
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015646.4-584s21c1
Sequence:CCGGTAGGGAAGGAACAAGGTCAAACTCGAGTTTGACCTTGTTCCTTCCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015646.4-745s21c1
Sequence:CCGGTCATGTCAGCTGCTTTAATATCTCGAGATATTAAAGCAGCTGACATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015646.4-616s21c1
Sequence:CCGGCAATGGAACAACTGTGCATTCCTCGAGGAATGCACAGTTGTTCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015646.4-893s21c1
Sequence:CCGGGGCGGATGAAAGCTACTATATCTCGAGATATAGTAGCTTTCATCCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015646.3-463s1c1
Sequence:CCGGCCAATGATTCTTGTTGGTAATCTCGAGATTACCAACAAGAATCATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015646.3-618s1c1
Sequence:CCGGAGTGCGGCAAATTAACAGAAACTCGAGTTTCTGTTAATTTGCCGCACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015646.3-234s1c1
Sequence:CCGGTCCTACGATAGAAGATTCTTACTCGAGTAAGAATCTTCTATCGTAGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015646.3-425s1c1
Sequence:CCGGGAGAACAGATTCTTCGAGTTACTCGAGTAACTCGAAGAATCTGTTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015646.3-277s1c1
Sequence:CCGGGCACAACAGTGTATGCTTGAACTCGAGTTCAAGCATACACTGTTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015646
VALIDATED
RAP1B MISSION shRNA Lentiviral Transduction Particles
RAP1B, member of RAS oncogene family
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015646.4-584s21c1
Sequence:CCGGTAGGGAAGGAACAAGGTCAAACTCGAGTTTGACCTTGTTCCTTCCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015646.4-745s21c1
Sequence:CCGGTCATGTCAGCTGCTTTAATATCTCGAGATATTAAAGCAGCTGACATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015646.4-616s21c1
Sequence:CCGGCAATGGAACAACTGTGCATTCCTCGAGGAATGCACAGTTGTTCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015646.4-893s21c1
Sequence:CCGGGGCGGATGAAAGCTACTATATCTCGAGATATAGTAGCTTTCATCCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015646.3-463s1c1
Sequence:CCGGCCAATGATTCTTGTTGGTAATCTCGAGATTACCAACAAGAATCATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015646.3-618s1c1
Sequence:CCGGAGTGCGGCAAATTAACAGAAACTCGAGTTTCTGTTAATTTGCCGCACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015646.3-234s1c1
Sequence:CCGGTCCTACGATAGAAGATTCTTACTCGAGTAAGAATCTTCTATCGTAGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015646.3-425s1c1
Sequence:CCGGGAGAACAGATTCTTCGAGTTACTCGAGTAACTCGAAGAATCTGTTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015646.3-277s1c1
Sequence:CCGGGCACAACAGTGTATGCTTGAACTCGAGTTCAAGCATACACTGTTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024457
VALIDATED
RAP1B MISSION shRNA Bacterial Glycerol Stock
RAP1B, member of RAS oncogene family
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024457.1-1235s1c1
Sequence:CCGGCGCTTTGATTAACACAGCTATCTCGAGATAGCTGTGTTAATCAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024457.1-567s1c1
Sequence:CCGGCCTAGCAAGACAGTGGAACAACTCGAGTTGTTCCACTGTCTTGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024457.1-268s1c1
Sequence:CCGGCCTACGATAGAAGATTCTTATCTCGAGATAAGAATCTTCTATCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024457.1-430s1c1
Sequence:CCGGTCGACATTTAACGACTTACAACTCGAGTTGTAAGTCGTTAAATGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024457.1-427s1c1
Sequence:CCGGCAGTCGACATTTAACGACTTACTCGAGTAAGTCGTTAAATGTCGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024457
VALIDATED
RAP1B MISSION shRNA shRNA Plasmid DNA
RAP1B, member of RAS oncogene family
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024457.1-1235s1c1
Sequence:CCGGCGCTTTGATTAACACAGCTATCTCGAGATAGCTGTGTTAATCAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024457.1-567s1c1
Sequence:CCGGCCTAGCAAGACAGTGGAACAACTCGAGTTGTTCCACTGTCTTGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024457.1-268s1c1
Sequence:CCGGCCTACGATAGAAGATTCTTATCTCGAGATAAGAATCTTCTATCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024457.1-430s1c1
Sequence:CCGGTCGACATTTAACGACTTACAACTCGAGTTGTAAGTCGTTAAATGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024457.1-427s1c1
Sequence:CCGGCAGTCGACATTTAACGACTTACTCGAGTAAGTCGTTAAATGTCGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024457
VALIDATED
RAP1B MISSION shRNA Lentiviral Transduction Particles
RAP1B, member of RAS oncogene family
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024457.1-1235s1c1
Sequence:CCGGCGCTTTGATTAACACAGCTATCTCGAGATAGCTGTGTTAATCAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024457.1-567s1c1
Sequence:CCGGCCTAGCAAGACAGTGGAACAACTCGAGTTGTTCCACTGTCTTGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024457.1-268s1c1
Sequence:CCGGCCTACGATAGAAGATTCTTATCTCGAGATAAGAATCTTCTATCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024457.1-430s1c1
Sequence:CCGGTCGACATTTAACGACTTACAACTCGAGTTGTAAGTCGTTAAATGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024457.1-427s1c1
Sequence:CCGGCAGTCGACATTTAACGACTTACTCGAGTAAGTCGTTAAATGTCGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)