EMAIL THIS PAGE TO A FRIEND

RAP1GAP

RAP1 GTPase activating protein

119 Gene Product Result for
Synonyms: RAP1GA1 RAP1GAP1 RAP1GAPII RAPGAP
Gene ID:
Human(5909) Summary: This gene encodes a type of GTPase-activating-protein (GAP) that down-regulates the activity of the ras-related RAP1 protein. RAP1 acts as a molecular switch by cycling between an inactive GDP-bound form and an active GTP-bound form. The product of this gene, RAP1GAP, promotes the hydrolysis of bound GTP and hence returns RAP1 to the inactive state whereas other proteins, guanine nucleotide exchange factors (GEFs), act as RAP1 activators by facilitating the conversion of RAP1 from the GDP- to the GTP-bound form. In general, ras subfamily proteins, such as RAP1, play key roles in receptor-linked signaling pathways that control cell growth and differentiation. RAP1 plays a role in diverse processes such as cell proliferation, adhesion, differentiation, and embryogenesis. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Aug 2011]
Mouse(110351) Rap1 GTPase-activating protein
Rat(313644) Rap1 GTPase-activating protein
Zebrafish(100538309) RAP1 GTPase activating protein
domestic cat(101093787) RAP1 GTPase activating protein
dog(487387) RAP1 GTPase activating protein
chicken(769475) RAP1 GTPase activating protein
Zebrafish(100144557) RAP1 GTPase activating protein
naked mole-rat(101726267) RAP1 GTPase activating protein
Domestic Rabbit(100340849) RAP1 GTPase activating protein
domestic guinea pig(100725658) RAP1 GTPase activating protein
cow(532839) RAP1 GTPase activating protein
sheep(101104377) RAP1 GTPase activating protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081155 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081155 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081155 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002885 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_149500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_149500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_149500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157131 MISSION® esiRNA esiRNA human RAP1GAP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002885 Rosetta Predictions human pricing
XM_001070178 Rosetta Predictions rat pricing
XM_233609 Rosetta Predictions rat pricing
NM_001081155 Rosetta Predictions mouse pricing
XM_149500 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042102 predicted 973
2 SASI_Hs01_00042103 predicted 455
3 SASI_Hs02_00334677 predicted 784
4 SASI_Hs01_00042104 predicted 883
5 SASI_Hs01_00042105 predicted 852
6 SASI_Hs01_00042106 predicted 1110
7 SASI_Hs01_00042109 predicted 1292
8 SASI_Hs01_00042110 predicted 420
9 SASI_Hs01_00042111 predicted 1130
10 SASI_Hs02_00334678 predicted 819
11 SASI_Hs01_00042107 predicted 1824
12 SASI_Hs01_00042108 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330692 predicted 607
2 SASI_Rn02_00330693 predicted 303
3 SASI_Rn02_00330694 predicted 1768
4 SASI_Rn02_00330695 predicted 1139
5 SASI_Rn02_00330696 predicted 770
6 SASI_Rn02_00330697 predicted 1160
7 SASI_Rn02_00330698 predicted 780
8 SASI_Rn02_00330699 predicted 1773
9 SASI_Rn02_00330700 predicted 201
10 SASI_Rn02_00330701 predicted 1322
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387917 predicted 610
2 SASI_Rn02_00387918 predicted 303
3 SASI_Rn02_00387919 predicted 1765
4 SASI_Rn02_00387920 predicted 1145
5 SASI_Rn02_00387921 predicted 775
6 SASI_Rn02_00387922 predicted 1157
7 SASI_Rn02_00387923 predicted 786
8 SASI_Rn02_00387924 predicted 1780
9 SASI_Rn02_00387925 predicted 200
10 SASI_Rn02_00387926 predicted 1326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081155 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295721 predicted 974
2 SASI_Mm02_00295722 predicted 1299
3 SASI_Mm02_00295723 predicted 1653
4 SASI_Mm02_00295724 predicted 669
5 SASI_Mm02_00295725 predicted 1129
6 SASI_Mm02_00295726 predicted 1280
7 SASI_Mm02_00295727 predicted 737
8 SASI_Mm02_00295728 predicted 1190
9 SASI_Mm02_00295729 predicted 460
10 SASI_Mm02_00295730 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_149500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260182 predicted 981
2 SASI_Mm01_00260183 predicted 1123
3 SASI_Mm01_00260184 predicted 1298
4 SASI_Mm01_00260185 predicted 1666
5 SASI_Mm01_00260186 predicted 675
6 SASI_Mm01_00260187 predicted 1138
7 SASI_Mm01_00260188 predicted 1284
8 SASI_Mm01_00260189 predicted 750
9 SASI_Mm01_00260190 predicted 1189
10 SASI_Mm01_00260191 predicted 462
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081155
RAP1GAP MISSION shRNA Bacterial Glycerol Stock
RAP1 GTPase activating protein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000334542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081155.1-1485s21c2
Sequence:CCGGCGAGTCTTTCAAGAGGGTCATCTCGAGATGACCCTCTTGAAAGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081155.1-2887s21c2
Sequence:CCGGCCAGTATCCTTGGTTGTGGATCTCGAGATCCACAACCAAGGATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081155.1-1315s21c2
Sequence:CCGGGCCGAGTATGCGTGTTACAAACTCGAGTTTGTAACACGCATACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081155.1-534s21c3
Sequence:CCGGCCTGGTATTCTCGCTCAAGTACTCGAGTACTTGAGCGAGAATACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081155
RAP1GAP MISSION shRNA shRNA Plasmid DNA
RAP1 GTPase activating protein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000334542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081155.1-1485s21c2
Sequence:CCGGCGAGTCTTTCAAGAGGGTCATCTCGAGATGACCCTCTTGAAAGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081155.1-2887s21c2
Sequence:CCGGCCAGTATCCTTGGTTGTGGATCTCGAGATCCACAACCAAGGATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081155.1-1315s21c2
Sequence:CCGGGCCGAGTATGCGTGTTACAAACTCGAGTTTGTAACACGCATACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081155.1-534s21c3
Sequence:CCGGCCTGGTATTCTCGCTCAAGTACTCGAGTACTTGAGCGAGAATACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081155
RAP1GAP MISSION shRNA Lentiviral Transduction Particles
RAP1 GTPase activating protein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000334542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081155.1-1485s21c2
Sequence:CCGGCGAGTCTTTCAAGAGGGTCATCTCGAGATGACCCTCTTGAAAGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081155.1-2887s21c2
Sequence:CCGGCCAGTATCCTTGGTTGTGGATCTCGAGATCCACAACCAAGGATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081155.1-1315s21c2
Sequence:CCGGGCCGAGTATGCGTGTTACAAACTCGAGTTTGTAACACGCATACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081155.1-534s21c3
Sequence:CCGGCCTGGTATTCTCGCTCAAGTACTCGAGTACTTGAGCGAGAATACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002885
VALIDATED
RAP1GAP MISSION shRNA Bacterial Glycerol Stock
RAP1 GTPase activating protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002885.2-2657s21c1
Sequence:CCGGAGCACAAGGAGGATGTGATATCTCGAGATATCACATCCTCCTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002885.2-833s21c1
Sequence:CCGGACTTCAAGTTTGGCGTCATTTCTCGAGAAATGACGCCAAACTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002885.1-531s1c2
Sequence:CCGGCCACCTTGTCTTCTCACTCAACTCGAGTTGAGTGAGAAGACAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002885.2-948s21c1
Sequence:CCGGGGTCAAACTGCAGGACTTTAACTCGAGTTAAAGTCCTGCAGTTTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002885.2-913s21c1
Sequence:CCGGGCTTTCGTGGAGTTCCTTGAACTCGAGTTCAAGGAACTCCACGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002885.1-856s1c1
Sequence:CCGGGCTTTCGTGGAGTTCCTTGAACTCGAGTTCAAGGAACTCCACGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002885.1-2775s1c1
Sequence:CCGGCCTGCCTTAGAAGGTAGGATTCTCGAGAATCCTACCTTCTAAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002885.1-1311s1c1
Sequence:CCGGCAATGCTGAATATGCCTGCTACTCGAGTAGCAGGCATATTCAGCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002885
VALIDATED
RAP1GAP MISSION shRNA shRNA Plasmid DNA
RAP1 GTPase activating protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002885.2-2657s21c1
Sequence:CCGGAGCACAAGGAGGATGTGATATCTCGAGATATCACATCCTCCTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002885.2-833s21c1
Sequence:CCGGACTTCAAGTTTGGCGTCATTTCTCGAGAAATGACGCCAAACTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002885.1-531s1c2
Sequence:CCGGCCACCTTGTCTTCTCACTCAACTCGAGTTGAGTGAGAAGACAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002885.2-948s21c1
Sequence:CCGGGGTCAAACTGCAGGACTTTAACTCGAGTTAAAGTCCTGCAGTTTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002885.2-913s21c1
Sequence:CCGGGCTTTCGTGGAGTTCCTTGAACTCGAGTTCAAGGAACTCCACGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002885.1-856s1c1
Sequence:CCGGGCTTTCGTGGAGTTCCTTGAACTCGAGTTCAAGGAACTCCACGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002885.1-2775s1c1
Sequence:CCGGCCTGCCTTAGAAGGTAGGATTCTCGAGAATCCTACCTTCTAAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002885.1-1311s1c1
Sequence:CCGGCAATGCTGAATATGCCTGCTACTCGAGTAGCAGGCATATTCAGCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002885
VALIDATED
RAP1GAP MISSION shRNA Lentiviral Transduction Particles
RAP1 GTPase activating protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002885.2-2657s21c1
Sequence:CCGGAGCACAAGGAGGATGTGATATCTCGAGATATCACATCCTCCTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002885.2-833s21c1
Sequence:CCGGACTTCAAGTTTGGCGTCATTTCTCGAGAAATGACGCCAAACTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002885.1-531s1c2
Sequence:CCGGCCACCTTGTCTTCTCACTCAACTCGAGTTGAGTGAGAAGACAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002885.2-948s21c1
Sequence:CCGGGGTCAAACTGCAGGACTTTAACTCGAGTTAAAGTCCTGCAGTTTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002885.2-913s21c1
Sequence:CCGGGCTTTCGTGGAGTTCCTTGAACTCGAGTTCAAGGAACTCCACGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002885.1-856s1c1
Sequence:CCGGGCTTTCGTGGAGTTCCTTGAACTCGAGTTCAAGGAACTCCACGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002885.1-2775s1c1
Sequence:CCGGCCTGCCTTAGAAGGTAGGATTCTCGAGAATCCTACCTTCTAAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002885.1-1311s1c1
Sequence:CCGGCAATGCTGAATATGCCTGCTACTCGAGTAGCAGGCATATTCAGCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_149500
VALIDATED
RAP1GAP MISSION shRNA Bacterial Glycerol Stock
RAP1 GTPase activating protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149500.5-3216s1c1
Sequence:CCGGCCAGTATCCTTGGTTGTGGATCTCGAGATCCACAACCAAGGATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149500.5-885s1c1
Sequence:CCGGCCTGGTATTCTCGCTCAAGTACTCGAGTACTTGAGCGAGAATACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149500.5-1666s1c1
Sequence:CCGGGCCGAGTATGCGTGTTACAAACTCGAGTTTGTAACACGCATACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149500.5-1836s1c1
Sequence:CCGGCGAGTCTTTCAAGAGGGTCATCTCGAGATGACCCTCTTGAAAGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149500.5-523s1c1
Sequence:CCGGCCCTACCCTAAGAACACAGATCTCGAGATCTGTGTTCTTAGGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_149500
VALIDATED
RAP1GAP MISSION shRNA shRNA Plasmid DNA
RAP1 GTPase activating protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149500.5-3216s1c1
Sequence:CCGGCCAGTATCCTTGGTTGTGGATCTCGAGATCCACAACCAAGGATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149500.5-885s1c1
Sequence:CCGGCCTGGTATTCTCGCTCAAGTACTCGAGTACTTGAGCGAGAATACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149500.5-1666s1c1
Sequence:CCGGGCCGAGTATGCGTGTTACAAACTCGAGTTTGTAACACGCATACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149500.5-1836s1c1
Sequence:CCGGCGAGTCTTTCAAGAGGGTCATCTCGAGATGACCCTCTTGAAAGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149500.5-523s1c1
Sequence:CCGGCCCTACCCTAAGAACACAGATCTCGAGATCTGTGTTCTTAGGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_149500
VALIDATED
RAP1GAP MISSION shRNA Lentiviral Transduction Particles
RAP1 GTPase activating protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149500.5-3216s1c1
Sequence:CCGGCCAGTATCCTTGGTTGTGGATCTCGAGATCCACAACCAAGGATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149500.5-885s1c1
Sequence:CCGGCCTGGTATTCTCGCTCAAGTACTCGAGTACTTGAGCGAGAATACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149500.5-1666s1c1
Sequence:CCGGGCCGAGTATGCGTGTTACAAACTCGAGTTTGTAACACGCATACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149500.5-1836s1c1
Sequence:CCGGCGAGTCTTTCAAGAGGGTCATCTCGAGATGACCCTCTTGAAAGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149500.5-523s1c1
Sequence:CCGGCCCTACCCTAAGAACACAGATCTCGAGATCTGTGTTCTTAGGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)