EMAIL THIS PAGE TO A FRIEND

RAP2B

RAP2B, member of RAS oncogene family

142 Gene Product Result for
UniProtKB ID: P61225, P17964, Q96EG5, Q9CXG0
Gene ID:
Human(5912) Summary: This intronless gene belongs to a family of RAS-related genes. The proteins encoded by these genes share approximately 50% amino acid identity with the classical RAS proteins and have numerous structural features in common. The most striking difference between the RAP and RAS proteins resides in their 61st amino acid: glutamine in RAS is replaced by threonine in RAP proteins. Evidence suggests that this protein may be polyisoprenylated and palmitoylated. [provided by RefSeq, Jul 2008]
Mouse(74012) RAP2B, member of RAS oncogene family
Rat(170923) RAP2B, member of RAS oncogene family
Zebrafish(414329) RAP2B, member of RAS oncogene family
chicken(417349) RAP2B, member of RAS oncogene family
dog(611828) RAP2B, member of RAS oncogene family
domestic guinea pig(100724041) RAP2B, member of RAS oncogene family
cow(784133) RAP2B, member of RAS oncogene family
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028712 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028712 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028712 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002886 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU035101 MISSION® esiRNA esiRNA targeting mouse Rap2b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002886 Rosetta Predictions human pricing
NM_133410 Rosetta Predictions rat pricing
NM_028712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334679 predicted 1090
2 SASI_Hs01_00179066 predicted 920
3 SASI_Hs01_00179067 predicted 1043
4 SASI_Hs01_00179068 predicted 1218
5 SASI_Hs01_00179069 predicted 1224
6 SASI_Hs01_00179070 predicted 1286
7 SASI_Hs01_00179071 predicted 1236
8 SASI_Hs01_00179072 predicted 1213
9 SASI_Hs01_00179073 predicted 1305
10 SASI_Hs01_00179074 predicted 1052
11 SASI_Hs01_00179065 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047084 predicted 310
2 SASI_Rn01_00047085 predicted 306
3 SASI_Rn01_00047086 predicted 317
4 SASI_Rn01_00047087 predicted 310
5 SASI_Rn01_00047088 predicted 302
6 SASI_Rn01_00047090 predicted 67
7 SASI_Rn01_00047091 predicted 448
8 SASI_Rn01_00047092 predicted 471
9 SASI_Rn01_00047093 predicted 343
10 SASI_Rn02_00267665 predicted 133
11 SASI_Rn01_00047089 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091504 predicted 921
2 SASI_Mm01_00091505 predicted 884
3 SASI_Mm02_00334248 predicted 1155
4 SASI_Mm01_00091507 predicted 900
5 SASI_Mm01_00091508 predicted 623
6 SASI_Mm01_00091509 predicted 871
7 SASI_Mm02_00334249 predicted 878
8 SASI_Mm01_00091510 predicted 1138
9 SASI_Mm01_00091511 predicted 914
10 SASI_Mm01_00091512 predicted 859
11 SASI_Mm01_00091506 predicted 1071
12 SASI_Mm01_00091513 predicted 1100
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028712
VALIDATED
RAP2B MISSION shRNA Bacterial Glycerol Stock
RAP2B, member of RAS oncogene family
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028712.4-731s21c1
Sequence:CCGGACGGAGCAGTTCGCCTCAATGCTCGAGCATTGAGGCGAACTGCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028712.4-1378s21c1
Sequence:CCGGCCCGTTTAAATAGCCATTAAGCTCGAGCTTAATGGCTATTTAAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028712.4-1029s21c1
Sequence:CCGGTCGTGAGGCAGATGAACTACGCTCGAGCGTAGTTCATCTGCCTCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028712.4-1001s21c1
Sequence:CCGGGCCTCAGTGGATGAGCTATTCCTCGAGGAATAGCTCATCCACTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028712.4-915s21c1
Sequence:CCGGGTGAACGTGAGGTCTCCTATGCTCGAGCATAGGAGACCTCACGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028712.4-1340s21c1
Sequence:CCGGGTGTACGTTCCTCGTTGATTTCTCGAGAAATCAACGAGGAACGTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028712.3-530s1c1
Sequence:CCGGGTTCGTAACAGGTTCCTTCATCTCGAGATGAAGGAACCTGTTACGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028712.3-539s1c1
Sequence:CCGGAGGTTCCTTCATCGAGAAGTACTCGAGTACTTCTCGATGAAGGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028712.3-786s1c1
Sequence:CCGGCGCGTACCCATGATCCTGGTACTCGAGTACCAGGATCATGGGTACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028712.4-787s21c1
Sequence:CCGGTCTCGTCTACAGCCTGGTCAACTCGAGTTGACCAGGCTGTAGACGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028712.3-527s1c1
Sequence:CCGGGCAGTTCGTAACAGGTTCCTTCTCGAGAAGGAACCTGTTACGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028712.3-2777s1c1
Sequence:CCGGCCAGCTAGTAACACCCTCTTACTCGAGTAAGAGGGTGTTACTAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028712
VALIDATED
RAP2B MISSION shRNA shRNA Plasmid DNA
RAP2B, member of RAS oncogene family
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028712.4-731s21c1
Sequence:CCGGACGGAGCAGTTCGCCTCAATGCTCGAGCATTGAGGCGAACTGCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028712.4-1378s21c1
Sequence:CCGGCCCGTTTAAATAGCCATTAAGCTCGAGCTTAATGGCTATTTAAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028712.4-1029s21c1
Sequence:CCGGTCGTGAGGCAGATGAACTACGCTCGAGCGTAGTTCATCTGCCTCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028712.4-1001s21c1
Sequence:CCGGGCCTCAGTGGATGAGCTATTCCTCGAGGAATAGCTCATCCACTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028712.4-915s21c1
Sequence:CCGGGTGAACGTGAGGTCTCCTATGCTCGAGCATAGGAGACCTCACGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028712.4-1340s21c1
Sequence:CCGGGTGTACGTTCCTCGTTGATTTCTCGAGAAATCAACGAGGAACGTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028712.3-530s1c1
Sequence:CCGGGTTCGTAACAGGTTCCTTCATCTCGAGATGAAGGAACCTGTTACGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028712.3-539s1c1
Sequence:CCGGAGGTTCCTTCATCGAGAAGTACTCGAGTACTTCTCGATGAAGGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028712.3-786s1c1
Sequence:CCGGCGCGTACCCATGATCCTGGTACTCGAGTACCAGGATCATGGGTACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028712.4-787s21c1
Sequence:CCGGTCTCGTCTACAGCCTGGTCAACTCGAGTTGACCAGGCTGTAGACGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028712.3-527s1c1
Sequence:CCGGGCAGTTCGTAACAGGTTCCTTCTCGAGAAGGAACCTGTTACGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028712.3-2777s1c1
Sequence:CCGGCCAGCTAGTAACACCCTCTTACTCGAGTAAGAGGGTGTTACTAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028712
VALIDATED
RAP2B MISSION shRNA Lentiviral Transduction Particles
RAP2B, member of RAS oncogene family
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028712.4-731s21c1
Sequence:CCGGACGGAGCAGTTCGCCTCAATGCTCGAGCATTGAGGCGAACTGCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028712.4-1378s21c1
Sequence:CCGGCCCGTTTAAATAGCCATTAAGCTCGAGCTTAATGGCTATTTAAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028712.4-1029s21c1
Sequence:CCGGTCGTGAGGCAGATGAACTACGCTCGAGCGTAGTTCATCTGCCTCACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028712.4-1001s21c1
Sequence:CCGGGCCTCAGTGGATGAGCTATTCCTCGAGGAATAGCTCATCCACTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028712.4-915s21c1
Sequence:CCGGGTGAACGTGAGGTCTCCTATGCTCGAGCATAGGAGACCTCACGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028712.4-1340s21c1
Sequence:CCGGGTGTACGTTCCTCGTTGATTTCTCGAGAAATCAACGAGGAACGTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028712.3-530s1c1
Sequence:CCGGGTTCGTAACAGGTTCCTTCATCTCGAGATGAAGGAACCTGTTACGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028712.3-539s1c1
Sequence:CCGGAGGTTCCTTCATCGAGAAGTACTCGAGTACTTCTCGATGAAGGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028712.3-786s1c1
Sequence:CCGGCGCGTACCCATGATCCTGGTACTCGAGTACCAGGATCATGGGTACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028712.4-787s21c1
Sequence:CCGGTCTCGTCTACAGCCTGGTCAACTCGAGTTGACCAGGCTGTAGACGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028712.3-527s1c1
Sequence:CCGGGCAGTTCGTAACAGGTTCCTTCTCGAGAAGGAACCTGTTACGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028712.3-2777s1c1
Sequence:CCGGCCAGCTAGTAACACCCTCTTACTCGAGTAAGAGGGTGTTACTAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002886
VALIDATED
RAP2B MISSION shRNA Bacterial Glycerol Stock
RAP2B, member of RAS oncogene family
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002886.2-528s21c1
Sequence:CCGGCGGGCTCCTTCATCGAGAAGTCTCGAGACTTCTCGATGAAGGAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002886.2-1050s21c1
Sequence:CCGGACGCATCCGACTCTCTAAATGCTCGAGCATTTAGAGAGTCGGATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002886.2-913s21c1
Sequence:CCGGAGACGAGCTATTTGCCGAGATCTCGAGATCTCGGCAAATAGCTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002886.2-1058s21c1
Sequence:CCGGGACTCTCTAAATGTGATTTATCTCGAGATAAATCACATTTAGAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002886.2-913s1c1
Sequence:CCGGAGACGAGCTATTTGCCGAGATCTCGAGATCTCGGCAAATAGCTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002886.2-551s1c1
Sequence:CCGGGACCCGACCATCGAAGACTTTCTCGAGAAAGTCTTCGATGGTCGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002886.2-528s1c1
Sequence:CCGGCGGGCTCCTTCATCGAGAAGTCTCGAGACTTCTCGATGAAGGAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002886.2-760s1c1
Sequence:CCGGCGTGAAGCGGTACGAGCGCGTCTCGAGACGCGCTCGTACCGCTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002886.2-905s1c1
Sequence:CCGGGCCTCGGTAGACGAGCTATTTCTCGAGAAATAGCTCGTCTACCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002886
VALIDATED
RAP2B MISSION shRNA shRNA Plasmid DNA
RAP2B, member of RAS oncogene family
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002886.2-528s21c1
Sequence:CCGGCGGGCTCCTTCATCGAGAAGTCTCGAGACTTCTCGATGAAGGAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002886.2-1050s21c1
Sequence:CCGGACGCATCCGACTCTCTAAATGCTCGAGCATTTAGAGAGTCGGATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002886.2-913s21c1
Sequence:CCGGAGACGAGCTATTTGCCGAGATCTCGAGATCTCGGCAAATAGCTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002886.2-1058s21c1
Sequence:CCGGGACTCTCTAAATGTGATTTATCTCGAGATAAATCACATTTAGAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002886.2-913s1c1
Sequence:CCGGAGACGAGCTATTTGCCGAGATCTCGAGATCTCGGCAAATAGCTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002886.2-551s1c1
Sequence:CCGGGACCCGACCATCGAAGACTTTCTCGAGAAAGTCTTCGATGGTCGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002886.2-528s1c1
Sequence:CCGGCGGGCTCCTTCATCGAGAAGTCTCGAGACTTCTCGATGAAGGAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002886.2-760s1c1
Sequence:CCGGCGTGAAGCGGTACGAGCGCGTCTCGAGACGCGCTCGTACCGCTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002886.2-905s1c1
Sequence:CCGGGCCTCGGTAGACGAGCTATTTCTCGAGAAATAGCTCGTCTACCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002886
VALIDATED
RAP2B MISSION shRNA Lentiviral Transduction Particles
RAP2B, member of RAS oncogene family
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002886.2-528s21c1
Sequence:CCGGCGGGCTCCTTCATCGAGAAGTCTCGAGACTTCTCGATGAAGGAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002886.2-1050s21c1
Sequence:CCGGACGCATCCGACTCTCTAAATGCTCGAGCATTTAGAGAGTCGGATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002886.2-913s21c1
Sequence:CCGGAGACGAGCTATTTGCCGAGATCTCGAGATCTCGGCAAATAGCTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002886.2-1058s21c1
Sequence:CCGGGACTCTCTAAATGTGATTTATCTCGAGATAAATCACATTTAGAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002886.2-913s1c1
Sequence:CCGGAGACGAGCTATTTGCCGAGATCTCGAGATCTCGGCAAATAGCTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002886.2-551s1c1
Sequence:CCGGGACCCGACCATCGAAGACTTTCTCGAGAAAGTCTTCGATGGTCGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002886.2-528s1c1
Sequence:CCGGCGGGCTCCTTCATCGAGAAGTCTCGAGACTTCTCGATGAAGGAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002886.2-760s1c1
Sequence:CCGGCGTGAAGCGGTACGAGCGCGTCTCGAGACGCGCTCGTACCGCTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002886.2-905s1c1
Sequence:CCGGGCCTCGGTAGACGAGCTATTTCTCGAGAAATAGCTCGTCTACCGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)