EMAIL THIS PAGE TO A FRIEND

RAPGEF1

Rap guanine nucleotide exchange factor (GEF) 1

112 Gene Product Result for
Synonyms: C3G GRF2
UniProtKB ID: Q13905, Q5JUE4, Q8IV73
Gene ID:
Human(2889) Summary: This gene encodes a human guanine nucleotide exchange factor. It transduces signals from CRK by binding the SH3 domain of CRK, and activating several members of the Ras family of GTPases. This signaling cascade that may be involved in apoptosis, integrin-mediated signal transduction, and cell transformation. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(107746) Rap guanine nucleotide exchange factor (GEF) 1
Rat(63881) Rap guanine nucleotide exchange factor (GEF) 1
chicken(417173) Rap guanine nucleotide exchange factor (GEF) 1
dog(491286) Rap guanine nucleotide exchange factor (GEF) 1
domestic cat(101099507) Rap guanine nucleotide exchange factor (GEF) 1
Horse(100069527) Rap guanine nucleotide exchange factor (GEF) 1
naked mole-rat(101714387) Rap guanine nucleotide exchange factor (GEF) 1
domestic guinea pig(100727953) Rap guanine nucleotide exchange factor (GEF) 1
cow(520454) Rap guanine nucleotide exchange factor (GEF) 1
sheep(101121164) Rap guanine nucleotide exchange factor (GEF) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054050 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054050 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054050 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005312 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005312 Rosetta Predictions human pricing
NM_198679 Rosetta Predictions human pricing
XM_001079347 Rosetta Predictions rat pricing
XM_216018 Rosetta Predictions rat pricing
NM_001039086 Rosetta Predictions mouse pricing
NM_001039087 Rosetta Predictions mouse pricing
NM_054050 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229768 predicted 3126
2 SASI_Hs01_00229769 predicted 2810
3 SASI_Hs01_00229770 predicted 468
4 SASI_Hs01_00229771 predicted 2258
5 SASI_Hs01_00229772 predicted 1839
6 SASI_Hs01_00229773 predicted 1064
7 SASI_Hs01_00229774 predicted 2762
8 SASI_Hs01_00229775 predicted 2894
9 SASI_Hs01_00229776 predicted 1079
10 SASI_Hs02_00339376 predicted 1989
11 SASI_Hs01_00229777 predicted 2134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101917 predicted 3207
2 SASI_Hs01_00101918 predicted 2889
3 SASI_Hs01_00101919 predicted 545
4 SASI_Hs01_00101920 predicted 2340
5 SASI_Hs01_00101921 predicted 1927
6 SASI_Hs01_00101922 predicted 1143
7 SASI_Hs01_00101923 predicted 2849
8 SASI_Hs01_00101924 predicted 2977
9 SASI_Hs01_00101925 predicted 1163
10 SASI_Hs02_00372245 predicted 2076
11 SASI_Hs01_00101926 predicted 2222
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079347 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364101 predicted 335
2 SASI_Rn02_00364102 predicted 3751
3 SASI_Rn02_00364103 predicted 2391
4 SASI_Rn02_00364104 predicted 1657
5 SASI_Rn02_00364105 predicted 1423
6 SASI_Rn02_00364106 predicted 460
7 SASI_Rn02_00364107 predicted 3269
8 SASI_Rn02_00364108 predicted 3212
9 SASI_Rn02_00364109 predicted 1320
10 SASI_Rn02_00364110 predicted 1703
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216018 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376386 predicted 2080
2 SASI_Rn02_00376387 predicted 1974
3 SASI_Rn02_00376388 predicted 2080
4 SASI_Rn02_00376389 predicted 202
5 SASI_Rn02_00376390 predicted 2087
6 SASI_Rn02_00376391 predicted 261
7 SASI_Rn02_00376392 predicted 1974
8 SASI_Rn02_00376393 predicted 2093
9 SASI_Rn02_00376394 predicted 195
10 SASI_Rn02_00376395 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289773 predicted 769
2 SASI_Mm01_00179751 predicted 2970
3 SASI_Mm01_00179752 predicted 1179
4 SASI_Mm01_00179753 predicted 3695
5 SASI_Mm01_00179755 predicted 1145
6 SASI_Mm01_00179756 predicted 3336
7 SASI_Mm02_00289774 predicted 3572
8 SASI_Mm01_00179758 predicted 3322
9 SASI_Mm01_00179759 predicted 3562
10 SASI_Mm01_00179760 predicted 3786
11 SASI_Mm01_00179754 predicted 3815
12 SASI_Mm01_00179757 predicted 3349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039087 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289775 predicted 889
2 SASI_Mm01_00033437 predicted 2986
3 SASI_Mm01_00033438 predicted 1286
4 SASI_Mm01_00033439 predicted 3714
5 SASI_Mm01_00033441 predicted 1264
6 SASI_Mm01_00033442 predicted 3351
7 SASI_Mm02_00289776 predicted 3596
8 SASI_Mm01_00033444 predicted 3339
9 SASI_Mm01_00033445 predicted 3581
10 SASI_Mm01_00033446 predicted 3804
11 SASI_Mm01_00033440 predicted 3837
12 SASI_Mm01_00033443 predicted 3362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054050 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337960 predicted 885
2 SASI_Mm01_00137334 predicted 2571
3 SASI_Mm01_00137335 predicted 1293
4 SASI_Mm01_00137336 predicted 3305
5 SASI_Mm01_00137338 predicted 1263
6 SASI_Mm01_00137339 predicted 2933
7 SASI_Mm02_00337961 predicted 3182
8 SASI_Mm01_00137341 predicted 2923
9 SASI_Mm01_00137342 predicted 3168
10 SASI_Mm01_00137343 predicted 3392
11 SASI_Mm01_00137337 predicted 3420
12 SASI_Mm01_00137340 predicted 2956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054050
VALIDATED
RAPGEF1 MISSION shRNA Bacterial Glycerol Stock
Rap guanine nucleotide exchange factor (GEF) 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054050.2-3551s21c1
Sequence:CCGGGCTGGCTGTGAGAACGCTCAACTCGAGTTGAGCGTTCTCACAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054050.1-3139s1c1
Sequence:CCGGGCACATTGATTGACAGCTCATCTCGAGATGAGCTGTCAATCAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054050.1-3264s1c1
Sequence:CCGGCCAGATTATATTGACGGGAAACTCGAGTTTCCCGTCAATATAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054050.1-3263s1c1
Sequence:CCGGCCCAGATTATATTGACGGGAACTCGAGTTCCCGTCAATATAATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054050.1-3507s1c1
Sequence:CCGGGCTGGCTGTGAGAACGCTCAACTCGAGTTGAGCGTTCTCACAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054050.1-2762s1c1
Sequence:CCGGGCCAGGAACCTTGCATGATTTCTCGAGAAATCATGCAAGGTTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054050.2-2806s21c1
Sequence:CCGGGCCAGGAACCTTGCATGATTTCTCGAGAAATCATGCAAGGTTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054050.2-3183s21c1
Sequence:CCGGGCACATTGATTGACAGCTCATCTCGAGATGAGCTGTCAATCAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054050.2-3307s21c1
Sequence:CCGGCCCAGATTATATTGACGGGAACTCGAGTTCCCGTCAATATAATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054050.2-633s21c1
Sequence:CCGGTCAGTGCCTTGCGCTACTTTACTCGAGTAAAGTAGCGCAAGGCACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054050
VALIDATED
RAPGEF1 MISSION shRNA shRNA Plasmid DNA
Rap guanine nucleotide exchange factor (GEF) 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054050.2-3551s21c1
Sequence:CCGGGCTGGCTGTGAGAACGCTCAACTCGAGTTGAGCGTTCTCACAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054050.1-3139s1c1
Sequence:CCGGGCACATTGATTGACAGCTCATCTCGAGATGAGCTGTCAATCAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054050.1-3264s1c1
Sequence:CCGGCCAGATTATATTGACGGGAAACTCGAGTTTCCCGTCAATATAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054050.1-3263s1c1
Sequence:CCGGCCCAGATTATATTGACGGGAACTCGAGTTCCCGTCAATATAATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054050.1-3507s1c1
Sequence:CCGGGCTGGCTGTGAGAACGCTCAACTCGAGTTGAGCGTTCTCACAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054050.1-2762s1c1
Sequence:CCGGGCCAGGAACCTTGCATGATTTCTCGAGAAATCATGCAAGGTTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054050.2-2806s21c1
Sequence:CCGGGCCAGGAACCTTGCATGATTTCTCGAGAAATCATGCAAGGTTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054050.2-3183s21c1
Sequence:CCGGGCACATTGATTGACAGCTCATCTCGAGATGAGCTGTCAATCAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054050.2-3307s21c1
Sequence:CCGGCCCAGATTATATTGACGGGAACTCGAGTTCCCGTCAATATAATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054050.2-633s21c1
Sequence:CCGGTCAGTGCCTTGCGCTACTTTACTCGAGTAAAGTAGCGCAAGGCACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054050
VALIDATED
RAPGEF1 MISSION shRNA Lentiviral Transduction Particles
Rap guanine nucleotide exchange factor (GEF) 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054050.2-3551s21c1
Sequence:CCGGGCTGGCTGTGAGAACGCTCAACTCGAGTTGAGCGTTCTCACAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054050.1-3139s1c1
Sequence:CCGGGCACATTGATTGACAGCTCATCTCGAGATGAGCTGTCAATCAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054050.1-3264s1c1
Sequence:CCGGCCAGATTATATTGACGGGAAACTCGAGTTTCCCGTCAATATAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054050.1-3263s1c1
Sequence:CCGGCCCAGATTATATTGACGGGAACTCGAGTTCCCGTCAATATAATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054050.1-3507s1c1
Sequence:CCGGGCTGGCTGTGAGAACGCTCAACTCGAGTTGAGCGTTCTCACAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_054050.1-2762s1c1
Sequence:CCGGGCCAGGAACCTTGCATGATTTCTCGAGAAATCATGCAAGGTTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054050.2-2806s21c1
Sequence:CCGGGCCAGGAACCTTGCATGATTTCTCGAGAAATCATGCAAGGTTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054050.2-3183s21c1
Sequence:CCGGGCACATTGATTGACAGCTCATCTCGAGATGAGCTGTCAATCAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054050.2-3307s21c1
Sequence:CCGGCCCAGATTATATTGACGGGAACTCGAGTTCCCGTCAATATAATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054050.2-633s21c1
Sequence:CCGGTCAGTGCCTTGCGCTACTTTACTCGAGTAAAGTAGCGCAAGGCACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005312
VALIDATED
RAPGEF1 MISSION shRNA Bacterial Glycerol Stock
Rap guanine nucleotide exchange factor (GEF) 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005312.2-847s21c1
Sequence:CCGGCGAGGTAGAGATCCTAAACAACTCGAGTTGTTTAGGATCTCTACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005312.2-3227s21c1
Sequence:CCGGCGGAGGAACGACGACATTATACTCGAGTATAATGTCGTCGTTCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005312.2-439s21c1
Sequence:CCGGCCTGCGCTACTTTAAGACCATCTCGAGATGGTCTTAAAGTAGCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005312.2-2896s1c1
Sequence:CCGGGCTGAATAACTTCAACTCCTACTCGAGTAGGAGTTGAAGTTATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005312.2-2389s21c1
Sequence:CCGGCGTCAGCAAGAACACGTTCTTCTCGAGAAGAACGTGTTCTTGCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005312.2-2896s21c1
Sequence:CCGGGCTGAATAACTTCAACTCCTACTCGAGTAGGAGTTGAAGTTATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005312.2-3227s1c1
Sequence:CCGGCGGAGGAACGACGACATTATACTCGAGTATAATGTCGTCGTTCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005312.2-439s1c1
Sequence:CCGGCCTGCGCTACTTTAAGACCATCTCGAGATGGTCTTAAAGTAGCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005312.2-847s1c1
Sequence:CCGGCGAGGTAGAGATCCTAAACAACTCGAGTTGTTTAGGATCTCTACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005312.2-2389s1c1
Sequence:CCGGCGTCAGCAAGAACACGTTCTTCTCGAGAAGAACGTGTTCTTGCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005312
VALIDATED
RAPGEF1 MISSION shRNA shRNA Plasmid DNA
Rap guanine nucleotide exchange factor (GEF) 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005312.2-847s21c1
Sequence:CCGGCGAGGTAGAGATCCTAAACAACTCGAGTTGTTTAGGATCTCTACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005312.2-3227s21c1
Sequence:CCGGCGGAGGAACGACGACATTATACTCGAGTATAATGTCGTCGTTCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005312.2-439s21c1
Sequence:CCGGCCTGCGCTACTTTAAGACCATCTCGAGATGGTCTTAAAGTAGCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005312.2-2896s1c1
Sequence:CCGGGCTGAATAACTTCAACTCCTACTCGAGTAGGAGTTGAAGTTATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005312.2-2389s21c1
Sequence:CCGGCGTCAGCAAGAACACGTTCTTCTCGAGAAGAACGTGTTCTTGCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005312.2-2896s21c1
Sequence:CCGGGCTGAATAACTTCAACTCCTACTCGAGTAGGAGTTGAAGTTATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005312.2-3227s1c1
Sequence:CCGGCGGAGGAACGACGACATTATACTCGAGTATAATGTCGTCGTTCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005312.2-439s1c1
Sequence:CCGGCCTGCGCTACTTTAAGACCATCTCGAGATGGTCTTAAAGTAGCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005312.2-847s1c1
Sequence:CCGGCGAGGTAGAGATCCTAAACAACTCGAGTTGTTTAGGATCTCTACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005312.2-2389s1c1
Sequence:CCGGCGTCAGCAAGAACACGTTCTTCTCGAGAAGAACGTGTTCTTGCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005312
VALIDATED
RAPGEF1 MISSION shRNA Lentiviral Transduction Particles
Rap guanine nucleotide exchange factor (GEF) 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005312.2-847s21c1
Sequence:CCGGCGAGGTAGAGATCCTAAACAACTCGAGTTGTTTAGGATCTCTACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005312.2-3227s21c1
Sequence:CCGGCGGAGGAACGACGACATTATACTCGAGTATAATGTCGTCGTTCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005312.2-439s21c1
Sequence:CCGGCCTGCGCTACTTTAAGACCATCTCGAGATGGTCTTAAAGTAGCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005312.2-2896s1c1
Sequence:CCGGGCTGAATAACTTCAACTCCTACTCGAGTAGGAGTTGAAGTTATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005312.2-2389s21c1
Sequence:CCGGCGTCAGCAAGAACACGTTCTTCTCGAGAAGAACGTGTTCTTGCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005312.2-2896s21c1
Sequence:CCGGGCTGAATAACTTCAACTCCTACTCGAGTAGGAGTTGAAGTTATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005312.2-3227s1c1
Sequence:CCGGCGGAGGAACGACGACATTATACTCGAGTATAATGTCGTCGTTCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005312.2-439s1c1
Sequence:CCGGCCTGCGCTACTTTAAGACCATCTCGAGATGGTCTTAAAGTAGCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005312.2-847s1c1
Sequence:CCGGCGAGGTAGAGATCCTAAACAACTCGAGTTGTTTAGGATCTCTACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005312.2-2389s1c1
Sequence:CCGGCGTCAGCAAGAACACGTTCTTCTCGAGAAGAACGTGTTCTTGCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)