EMAIL THIS PAGE TO A FRIEND

RAPGEF2

Rap guanine nucleotide exchange factor (GEF) 2

278 Gene Product Result for
Synonyms: CNrasGEF NRAPGEP PDZ-GEF1 PDZGEF1 RA-GEF Rap-GEP nRap GEP
UniProtKB ID: Q9Y4G8, D3DP27
Gene ID:
Human(9693) Summary: Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF2, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]
Mouse(76089) Rap guanine nucleotide exchange factor (GEF) 2
Rat(310533) Rap guanine nucleotide exchange factor (GEF) 2
Zebrafish(557693) Rap guanine nucleotide exchange factor (GEF) 2
domestic cat(101084954) Rap guanine nucleotide exchange factor (GEF) 2
Horse(100069003) Rap guanine nucleotide exchange factor (GEF) 2
dog(482670) Rap guanine nucleotide exchange factor (GEF) 2
chicken(422418) Rap guanine nucleotide exchange factor (GEF) 2
cow(100139484) Rap guanine nucleotide exchange factor (GEF) 2
sheep(101111578) Rap guanine nucleotide exchange factor (GEF) 2
domestic guinea pig(100725060) Rap guanine nucleotide exchange factor (GEF) 2
naked mole-rat(101718791) Rap guanine nucleotide exchange factor (GEF) 2
Domestic Rabbit(100346752) Rap guanine nucleotide exchange factor (GEF) 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376350 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001099624 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001099624 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001099624 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014247 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014247 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014247 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014247 Rosetta Predictions human pricing
XM_376350 Rosetta Predictions human pricing
XM_930387 Rosetta Predictions human pricing
XM_934710 Rosetta Predictions human pricing
XM_934712 Rosetta Predictions human pricing
XM_934714 Rosetta Predictions human pricing
XM_934715 Rosetta Predictions human pricing
XM_934716 Rosetta Predictions human pricing
XM_934717 Rosetta Predictions human pricing
XM_934718 Rosetta Predictions human pricing
NM_001107684 Rosetta Predictions rat pricing
NM_001099624 Rosetta Predictions mouse pricing
XM_203999 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345293 predicted 2503
2 SASI_Hs02_00345294 predicted 1112
3 SASI_Hs02_00345295 predicted 1951
4 SASI_Hs02_00345296 predicted 2242
5 SASI_Hs02_00345297 predicted 3063
6 SASI_Hs02_00345298 predicted 2340
7 SASI_Hs02_00345299 predicted 3313
8 SASI_Hs02_00345300 predicted 993
9 SASI_Hs02_00345301 predicted 727
10 SASI_Hs02_00345302 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270462 predicted 2737
2 SASI_Hs01_00270463 predicted 1345
3 SASI_Hs01_00270464 predicted 2180
4 SASI_Hs01_00270465 predicted 2475
5 SASI_Hs01_00270466 predicted 3286
6 SASI_Hs01_00270467 predicted 2572
7 SASI_Hs01_00270468 predicted 3547
8 SASI_Hs01_00270469 predicted 1224
9 SASI_Hs01_00270470 predicted 959
10 SASI_Hs01_00270471 predicted 1516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267752 predicted 2737
2 SASI_Hs01_00267753 predicted 1339
3 SASI_Hs01_00267754 predicted 2185
4 SASI_Hs01_00267755 predicted 2480
5 SASI_Hs01_00267756 predicted 3291
6 SASI_Hs01_00267757 predicted 2568
7 SASI_Hs01_00267758 predicted 3545
8 SASI_Hs01_00267759 predicted 1224
9 SASI_Hs01_00267760 predicted 959
10 SASI_Hs01_00267761 predicted 1515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259643 predicted 664
2 SASI_Hs01_00259644 predicted 851
3 SASI_Hs01_00259645 predicted 1345
4 SASI_Hs01_00259646 predicted 1405
5 SASI_Hs01_00259647 predicted 977
6 SASI_Hs01_00259648 predicted 655
7 SASI_Hs01_00259649 predicted 907
8 SASI_Hs01_00259650 predicted 1214
9 SASI_Hs01_00259651 predicted 952
10 SASI_Hs01_00259652 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284919 predicted 2735
2 SASI_Hs01_00284920 predicted 1342
3 SASI_Hs01_00284921 predicted 2186
4 SASI_Hs01_00284922 predicted 2474
5 SASI_Hs01_00284923 predicted 3289
6 SASI_Hs01_00284924 predicted 2571
7 SASI_Hs01_00284925 predicted 3538
8 SASI_Hs01_00284926 predicted 1223
9 SASI_Hs01_00284927 predicted 958
10 SASI_Hs01_00284928 predicted 1515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294745 predicted 2734
2 SASI_Hs01_00294746 predicted 849
3 SASI_Hs01_00294747 predicted 1344
4 SASI_Hs01_00294748 predicted 2179
5 SASI_Hs01_00294749 predicted 2480
6 SASI_Hs01_00294750 predicted 3288
7 SASI_Hs01_00294751 predicted 2577
8 SASI_Hs01_00294752 predicted 3544
9 SASI_Hs01_00294753 predicted 1217
10 SASI_Hs01_00294754 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293428 predicted 666
2 SASI_Hs01_00293429 predicted 1765
3 SASI_Hs01_00293430 predicted 854
4 SASI_Hs01_00293431 predicted 1345
5 SASI_Hs01_00293432 predicted 980
6 SASI_Hs01_00293433 predicted 906
7 SASI_Hs01_00293434 predicted 1214
8 SASI_Hs01_00293435 predicted 953
9 SASI_Hs01_00293436 predicted 1508
10 SASI_Hs01_00293437 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256699 predicted 1044
2 SASI_Hs01_00256700 predicted 1026
3 SASI_Hs01_00256701 predicted 316
4 SASI_Hs01_00256702 predicted 285
5 SASI_Hs01_00256703 predicted 213
6 SASI_Hs01_00256704 predicted 1282
7 SASI_Hs01_00256705 predicted 1830
8 SASI_Hs01_00256706 predicted 1598
9 SASI_Hs01_00256707 predicted 1298
10 SASI_Hs01_00256708 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249629 predicted 2657
2 SASI_Hs01_00249630 predicted 1264
3 SASI_Hs01_00249631 predicted 2095
4 SASI_Hs01_00249632 predicted 3206
5 SASI_Hs01_00249633 predicted 2488
6 SASI_Hs01_00249634 predicted 3457
7 SASI_Hs01_00249635 predicted 374
8 SASI_Hs01_00249636 predicted 1142
9 SASI_Hs01_00249637 predicted 871
10 SASI_Hs01_00249638 predicted 1427
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266555 predicted 2504
2 SASI_Hs01_00266556 predicted 1109
3 SASI_Hs01_00266557 predicted 1947
4 SASI_Hs01_00266558 predicted 3058
5 SASI_Hs01_00266559 predicted 2335
6 SASI_Hs01_00266560 predicted 3307
7 SASI_Hs01_00266561 predicted 221
8 SASI_Hs01_00266562 predicted 980
9 SASI_Hs01_00266563 predicted 715
10 SASI_Hs01_00266564 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231255 predicted 1697
2 SASI_Rn02_00231256 predicted 832
3 SASI_Rn02_00231257 predicted 3448
4 SASI_Rn02_00231258 predicted 3250
5 SASI_Rn02_00231259 predicted 4284
6 SASI_Rn02_00231260 predicted 522
7 SASI_Rn02_00231261 predicted 2412
8 SASI_Rn02_00231262 predicted 815
9 SASI_Rn02_00231263 predicted 3397
10 SASI_Rn02_00231264 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099624 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301835 predicted 3914
2 SASI_Mm02_00301836 predicted 2080
3 SASI_Mm02_00301837 predicted 3232
4 SASI_Mm02_00301838 predicted 1145
5 SASI_Mm02_00301839 predicted 1013
6 SASI_Mm02_00301840 predicted 3473
7 SASI_Mm02_00301841 predicted 725
8 SASI_Mm02_00301842 predicted 2675
9 SASI_Mm02_00301843 predicted 3218
10 SASI_Mm02_00301844 predicted 2794
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_203999 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282897 predicted 4908
2 SASI_Mm01_00282898 predicted 3070
3 SASI_Mm01_00282899 predicted 4227
4 SASI_Mm01_00282900 predicted 2138
5 SASI_Mm01_00282901 predicted 2009
6 SASI_Mm01_00282902 predicted 1718
7 SASI_Mm01_00282903 predicted 1402
8 SASI_Mm01_00282904 predicted 3622
9 SASI_Mm01_00282905 predicted 3670
10 SASI_Mm01_00282906 predicted 4210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376350
VALIDATED
RAPGEF2 MISSION shRNA Bacterial Glycerol Stock
Rap guanine nucleotide exchange factor (GEF) 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000036985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376350.1-2262s1c1
Sequence:CCGGCGCAACATTGAACCTACTGAACTCGAGTTCAGTAGGTTCAATGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376350.1-743s1c1
Sequence:CCGGCCAGCAAGATTACTGCCGTATCTCGAGATACGGCAGTAATCTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376350.1-1707s1c1
Sequence:CCGGCCATACAATGATATTGGGATTCTCGAGAATCCCAATATCATTGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376350.1-3759s1c1
Sequence:CCGGCGGACCATGATTGAACCTGATCTCGAGATCAGGTTCAATCATGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376350
VALIDATED
RAPGEF2 MISSION shRNA shRNA Plasmid DNA
Rap guanine nucleotide exchange factor (GEF) 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000036985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376350.1-2262s1c1
Sequence:CCGGCGCAACATTGAACCTACTGAACTCGAGTTCAGTAGGTTCAATGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376350.1-743s1c1
Sequence:CCGGCCAGCAAGATTACTGCCGTATCTCGAGATACGGCAGTAATCTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376350.1-1707s1c1
Sequence:CCGGCCATACAATGATATTGGGATTCTCGAGAATCCCAATATCATTGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376350.1-3759s1c1
Sequence:CCGGCGGACCATGATTGAACCTGATCTCGAGATCAGGTTCAATCATGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376350
VALIDATED
RAPGEF2 MISSION shRNA Lentiviral Transduction Particles
Rap guanine nucleotide exchange factor (GEF) 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000036985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376350.1-2262s1c1
Sequence:CCGGCGCAACATTGAACCTACTGAACTCGAGTTCAGTAGGTTCAATGTTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376350.1-743s1c1
Sequence:CCGGCCAGCAAGATTACTGCCGTATCTCGAGATACGGCAGTAATCTTGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376350.1-1707s1c1
Sequence:CCGGCCATACAATGATATTGGGATTCTCGAGAATCCCAATATCATTGTATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376350.1-3759s1c1
Sequence:CCGGCGGACCATGATTGAACCTGATCTCGAGATCAGGTTCAATCATGGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099624
VALIDATED
RAPGEF2 MISSION shRNA Bacterial Glycerol Stock
Rap guanine nucleotide exchange factor (GEF) 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000239102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099624.2-5997s21c1
Sequence:CCGGGATCAGTAGATAAACGTAAATCTCGAGATTTACGTTTATCTACTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099624.2-3621s21c1
Sequence:CCGGCCTGATGGAGCCTGATCAATACTCGAGTATTGATCAGGCTCCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099624.2-728s21c1
Sequence:CCGGAGCAAGATTACTGCCGTATTTCTCGAGAAATACGGCAGTAATCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099624.2-1026s21c1
Sequence:CCGGTAAGGTGACGCGGGTAGTATTCTCGAGAATACTACCCGCGTCACCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099624
VALIDATED
RAPGEF2 MISSION shRNA shRNA Plasmid DNA
Rap guanine nucleotide exchange factor (GEF) 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000239102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099624.2-5997s21c1
Sequence:CCGGGATCAGTAGATAAACGTAAATCTCGAGATTTACGTTTATCTACTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099624.2-3621s21c1
Sequence:CCGGCCTGATGGAGCCTGATCAATACTCGAGTATTGATCAGGCTCCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099624.2-728s21c1
Sequence:CCGGAGCAAGATTACTGCCGTATTTCTCGAGAAATACGGCAGTAATCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099624.2-1026s21c1
Sequence:CCGGTAAGGTGACGCGGGTAGTATTCTCGAGAATACTACCCGCGTCACCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099624
VALIDATED
RAPGEF2 MISSION shRNA Lentiviral Transduction Particles
Rap guanine nucleotide exchange factor (GEF) 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000239102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001099624.2-5997s21c1
Sequence:CCGGGATCAGTAGATAAACGTAAATCTCGAGATTTACGTTTATCTACTGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099624.2-3621s21c1
Sequence:CCGGCCTGATGGAGCCTGATCAATACTCGAGTATTGATCAGGCTCCATCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099624.2-728s21c1
Sequence:CCGGAGCAAGATTACTGCCGTATTTCTCGAGAAATACGGCAGTAATCTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099624.2-1026s21c1
Sequence:CCGGTAAGGTGACGCGGGTAGTATTCTCGAGAATACTACCCGCGTCACCTTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014247
RAPGEF2 MISSION shRNA Bacterial Glycerol Stock
Rap guanine nucleotide exchange factor (GEF) 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014247.2-2479s21c1
Sequence:CCGGACAGCTCTCTATGCGAAATTTCTCGAGAAATTTCGCATAGAGAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014247.2-3891s21c1
Sequence:CCGGTGATTGAACCTGATCAGTATACTCGAGTATACTGATCAGGTTCAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014247.2-5208s21c1
Sequence:CCGGCTTGATCTCATTGGGATAATGCTCGAGCATTATCCCAATGAGATCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014247.2-2348s21c1
Sequence:CCGGCAACTGAGTGGAAGGTATTATCTCGAGATAATACCTTCCACTCAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014247.2-1291s21c1
Sequence:CCGGTAAGGTTACACGGGTAGTATTCTCGAGAATACTACCCGTGTAACCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014247
RAPGEF2 MISSION shRNA shRNA Plasmid DNA
Rap guanine nucleotide exchange factor (GEF) 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014247.2-2479s21c1
Sequence:CCGGACAGCTCTCTATGCGAAATTTCTCGAGAAATTTCGCATAGAGAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014247.2-3891s21c1
Sequence:CCGGTGATTGAACCTGATCAGTATACTCGAGTATACTGATCAGGTTCAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014247.2-5208s21c1
Sequence:CCGGCTTGATCTCATTGGGATAATGCTCGAGCATTATCCCAATGAGATCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014247.2-2348s21c1
Sequence:CCGGCAACTGAGTGGAAGGTATTATCTCGAGATAATACCTTCCACTCAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014247.2-1291s21c1
Sequence:CCGGTAAGGTTACACGGGTAGTATTCTCGAGAATACTACCCGTGTAACCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014247
RAPGEF2 MISSION shRNA Lentiviral Transduction Particles
Rap guanine nucleotide exchange factor (GEF) 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014247.2-2479s21c1
Sequence:CCGGACAGCTCTCTATGCGAAATTTCTCGAGAAATTTCGCATAGAGAGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014247.2-3891s21c1
Sequence:CCGGTGATTGAACCTGATCAGTATACTCGAGTATACTGATCAGGTTCAATCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014247.2-5208s21c1
Sequence:CCGGCTTGATCTCATTGGGATAATGCTCGAGCATTATCCCAATGAGATCAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014247.2-2348s21c1
Sequence:CCGGCAACTGAGTGGAAGGTATTATCTCGAGATAATACCTTCCACTCAGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014247.2-1291s21c1
Sequence:CCGGTAAGGTTACACGGGTAGTATTCTCGAGAATACTACCCGTGTAACCTTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)