EMAIL THIS PAGE TO A FRIEND

RAPGEF4

Rap guanine nucleotide exchange factor (GEF) 4

129 Gene Product Result for
Synonyms: CAMP-GEFII CGEF2 EPAC2 Nbla00496
UniProtKB ID: Q8WZA2, B2R7R3, B7Z912, O95636, Q8IXK6, Q8TAA4
Gene ID:
Mouse(56508) Rap guanine nucleotide exchange factor (GEF) 4
Rat(252857) Rap guanine nucleotide exchange factor (GEF) 4
Zebrafish(559170) Rap guanine nucleotide exchange factor (GEF) 4
Horse(100064121) Rap guanine nucleotide exchange factor (GEF) 4
domestic cat(101092955) Rap guanine nucleotide exchange factor (GEF) 4
dog(488402) Rap guanine nucleotide exchange factor (GEF) 4
chicken(429022) Rap guanine nucleotide exchange factor (GEF) 4
cow(537312) Rap guanine nucleotide exchange factor (GEF) 4
sheep(101112196) Rap guanine nucleotide exchange factor (GEF) 4
domestic guinea pig(100730964) Rap guanine nucleotide exchange factor (GEF) 4
naked mole-rat(101706913) Rap guanine nucleotide exchange factor (GEF) 4
Domestic Rabbit(100348394) Rap guanine nucleotide exchange factor (GEF) 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019688 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019688 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019688 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007023 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007023 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007023 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100397 Rosetta Predictions human pricing
NM_007023 Rosetta Predictions human pricing
XM_001060956 Rosetta Predictions rat pricing
XM_215985 Rosetta Predictions rat pricing
NM_019688 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321914 predicted 2111
2 SASI_Hs02_00321915 predicted 1038
3 SASI_Hs02_00321916 predicted 3053
4 SASI_Hs02_00321917 predicted 1944
5 SASI_Hs02_00321918 predicted 2763
6 SASI_Hs02_00321919 predicted 1666
7 SASI_Hs02_00321920 predicted 1204
8 SASI_Hs02_00321921 predicted 2157
9 SASI_Hs02_00321922 predicted 735
10 SASI_Hs02_00321923 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017744 predicted 2358
2 SASI_Hs01_00017745 predicted 1285
3 SASI_Hs02_00342786 predicted 3294
4 SASI_Hs01_00017746 predicted 2190
5 SASI_Hs01_00017747 predicted 2997
6 SASI_Hs02_00342787 predicted 1913
7 SASI_Hs02_00342788 predicted 1450
8 SASI_Hs01_00017748 predicted 2398
9 SASI_Hs01_00017751 predicted 975
10 SASI_Hs01_00017753 predicted 1245
11 SASI_Hs01_00017749 predicted 1556
12 SASI_Hs01_00017750 predicted 334
13 SASI_Hs01_00017752 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298272 predicted 537
2 SASI_Rn02_00298273 predicted 1129
3 SASI_Rn02_00298274 predicted 2200
4 SASI_Rn02_00298275 predicted 1207
5 SASI_Rn02_00298276 predicted 2610
6 SASI_Rn02_00298277 predicted 261
7 SASI_Rn02_00298278 predicted 1633
8 SASI_Rn02_00298279 predicted 2378
9 SASI_Rn02_00298280 predicted 2990
10 SASI_Rn02_00298281 predicted 1291
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215985 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376346 predicted 2406
2 SASI_Rn02_00376347 predicted 2420
3 SASI_Rn02_00376348 predicted 2807
4 SASI_Rn02_00376349 predicted 2884
5 SASI_Rn02_00376350 predicted 1834
6 SASI_Rn02_00376351 predicted 2578
7 SASI_Rn02_00376352 predicted 3047
8 SASI_Rn02_00376353 predicted 3184
9 SASI_Rn02_00376354 predicted 1483
10 SASI_Rn02_00376355 predicted 2628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062285 predicted 2320
2 SASI_Mm01_00062286 predicted 1042
3 SASI_Mm01_00062288 predicted 1111
4 SASI_Mm02_00324771 predicted 2592
5 SASI_Mm01_00062289 predicted 1833
6 SASI_Mm01_00062290 predicted 1190
7 SASI_Mm01_00062291 predicted 1391
8 SASI_Mm01_00062292 predicted 220
9 SASI_Mm01_00062293 predicted 2341
10 SASI_Mm02_00324772 predicted 1820
11 SASI_Mm01_00062287 predicted 2397
12 SASI_Mm01_00062294 predicted 1548
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019688
VALIDATED
RAPGEF4 MISSION shRNA Bacterial Glycerol Stock
Rap guanine nucleotide exchange factor (GEF) 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019688.1-253s1c1
Sequence:CCGGGCTGGGTCTTTGGATGTTAAACTCGAGTTTAACATCCAAAGACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019688.1-997s1c1
Sequence:CCGGCTCCTTCATATTAAAGCCTTACTCGAGTAAGGCTTTAATATGAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000452055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019688.1-2343s21c1
Sequence:CCGGCACATTTGGAAGGCATAATTTCTCGAGAAATTATGCCTTCCAAATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019688.1-2898s21c1
Sequence:CCGGGAGTTATGTACGGCAATTAAACTCGAGTTTAATTGCCGTACATAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019688.1-2601s1c1
Sequence:CCGGGCCGAGCAAGTTTAAGAAGTTCTCGAGAACTTCTTAAACTTGCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019688.1-996s1c1
Sequence:CCGGGCTCCTTCATATTAAAGCCTTCTCGAGAAGGCTTTAATATGAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019688.1-2107s1c1
Sequence:CCGGGTGGTGCTGAAATCTAATGATCTCGAGATCATTAGATTTCAGCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019688.1-1496s21c1
Sequence:CCGGGCCTTGAGCCATCGTTGAATGCTCGAGCATTCAACGATGGCTCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019688.1-2859s21c1
Sequence:CCGGGGATGCCGCTCAAGCTAATAACTCGAGTTATTAGCTTGAGCGGCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019688.1-2766s21c1
Sequence:CCGGGTTCATTGACAATCTAGTAAACTCGAGTTTACTAGATTGTCAATGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019688
VALIDATED
RAPGEF4 MISSION shRNA shRNA Plasmid DNA
Rap guanine nucleotide exchange factor (GEF) 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019688.1-253s1c1
Sequence:CCGGGCTGGGTCTTTGGATGTTAAACTCGAGTTTAACATCCAAAGACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019688.1-997s1c1
Sequence:CCGGCTCCTTCATATTAAAGCCTTACTCGAGTAAGGCTTTAATATGAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000452055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019688.1-2343s21c1
Sequence:CCGGCACATTTGGAAGGCATAATTTCTCGAGAAATTATGCCTTCCAAATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000448487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019688.1-2898s21c1
Sequence:CCGGGAGTTATGTACGGCAATTAAACTCGAGTTTAATTGCCGTACATAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019688.1-2601s1c1
Sequence:CCGGGCCGAGCAAGTTTAAGAAGTTCTCGAGAACTTCTTAAACTTGCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019688.1-996s1c1
Sequence:CCGGGCTCCTTCATATTAAAGCCTTCTCGAGAAGGCTTTAATATGAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019688.1-2107s1c1
Sequence:CCGGGTGGTGCTGAAATCTAATGATCTCGAGATCATTAGATTTCAGCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019688.1-1496s21c1
Sequence:CCGGGCCTTGAGCCATCGTTGAATGCTCGAGCATTCAACGATGGCTCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000448585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019688.1-2859s21c1
Sequence:CCGGGGATGCCGCTCAAGCTAATAACTCGAGTTATTAGCTTGAGCGGCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019688.1-2766s21c1
Sequence:CCGGGTTCATTGACAATCTAGTAAACTCGAGTTTACTAGATTGTCAATGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019688
VALIDATED
RAPGEF4 MISSION shRNA Lentiviral Transduction Particles
Rap guanine nucleotide exchange factor (GEF) 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019688.1-253s1c1
Sequence:CCGGGCTGGGTCTTTGGATGTTAAACTCGAGTTTAACATCCAAAGACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019688.1-997s1c1
Sequence:CCGGCTCCTTCATATTAAAGCCTTACTCGAGTAAGGCTTTAATATGAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000452055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019688.1-2343s21c1
Sequence:CCGGCACATTTGGAAGGCATAATTTCTCGAGAAATTATGCCTTCCAAATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019688.1-2898s21c1
Sequence:CCGGGAGTTATGTACGGCAATTAAACTCGAGTTTAATTGCCGTACATAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019688.1-2601s1c1
Sequence:CCGGGCCGAGCAAGTTTAAGAAGTTCTCGAGAACTTCTTAAACTTGCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019688.1-996s1c1
Sequence:CCGGGCTCCTTCATATTAAAGCCTTCTCGAGAAGGCTTTAATATGAAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019688.1-2107s1c1
Sequence:CCGGGTGGTGCTGAAATCTAATGATCTCGAGATCATTAGATTTCAGCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019688.1-1496s21c1
Sequence:CCGGGCCTTGAGCCATCGTTGAATGCTCGAGCATTCAACGATGGCTCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019688.1-2859s21c1
Sequence:CCGGGGATGCCGCTCAAGCTAATAACTCGAGTTATTAGCTTGAGCGGCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019688.1-2766s21c1
Sequence:CCGGGTTCATTGACAATCTAGTAAACTCGAGTTTACTAGATTGTCAATGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007023
RAPGEF4 MISSION shRNA Bacterial Glycerol Stock
Rap guanine nucleotide exchange factor (GEF) 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007023.1-188s1c1
Sequence:CCGGCCAGCGAAGATGTGGATATAACTCGAGTTATATCCACATCTTCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007023.1-2662s1c1
Sequence:CCGGGCCCACTGTAAGGAGTATAAACTCGAGTTTATACTCCTTACAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007023.1-3058s1c1
Sequence:CCGGCGGAGTTATGTACGGCAATTACTCGAGTAATTGCCGTACATAACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007023.1-2105s1c1
Sequence:CCGGGCTCTGATGAAGTTCTGTTTACTCGAGTAAACAGAACTTCATCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007023.1-361s1c1
Sequence:CCGGGCAGGGTCTTTGGATGTTAAACTCGAGTTTAACATCCAAAGACCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007023.3-396s21c1
Sequence:CCGGTATTTCGCCAGGGTGATATTGCTCGAGCAATATCACCCTGGCGAAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007023.3-1733s21c1
Sequence:CCGGATACGCCTTGAGGCAACTTTACTCGAGTAAAGTTGCCTCAAGGCGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007023.3-2701s21c1
Sequence:CCGGCAAGCGTGTTCAGCTATTAAACTCGAGTTTAATAGCTGAACACGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007023
RAPGEF4 MISSION shRNA shRNA Plasmid DNA
Rap guanine nucleotide exchange factor (GEF) 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007023.1-188s1c1
Sequence:CCGGCCAGCGAAGATGTGGATATAACTCGAGTTATATCCACATCTTCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007023.1-2662s1c1
Sequence:CCGGGCCCACTGTAAGGAGTATAAACTCGAGTTTATACTCCTTACAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007023.1-3058s1c1
Sequence:CCGGCGGAGTTATGTACGGCAATTACTCGAGTAATTGCCGTACATAACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007023.1-2105s1c1
Sequence:CCGGGCTCTGATGAAGTTCTGTTTACTCGAGTAAACAGAACTTCATCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007023.1-361s1c1
Sequence:CCGGGCAGGGTCTTTGGATGTTAAACTCGAGTTTAACATCCAAAGACCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007023.3-396s21c1
Sequence:CCGGTATTTCGCCAGGGTGATATTGCTCGAGCAATATCACCCTGGCGAAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007023.3-1733s21c1
Sequence:CCGGATACGCCTTGAGGCAACTTTACTCGAGTAAAGTTGCCTCAAGGCGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007023.3-2701s21c1
Sequence:CCGGCAAGCGTGTTCAGCTATTAAACTCGAGTTTAATAGCTGAACACGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007023
RAPGEF4 MISSION shRNA Lentiviral Transduction Particles
Rap guanine nucleotide exchange factor (GEF) 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007023.1-188s1c1
Sequence:CCGGCCAGCGAAGATGTGGATATAACTCGAGTTATATCCACATCTTCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007023.1-2662s1c1
Sequence:CCGGGCCCACTGTAAGGAGTATAAACTCGAGTTTATACTCCTTACAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007023.1-3058s1c1
Sequence:CCGGCGGAGTTATGTACGGCAATTACTCGAGTAATTGCCGTACATAACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007023.1-2105s1c1
Sequence:CCGGGCTCTGATGAAGTTCTGTTTACTCGAGTAAACAGAACTTCATCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007023.1-361s1c1
Sequence:CCGGGCAGGGTCTTTGGATGTTAAACTCGAGTTTAACATCCAAAGACCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007023.3-396s21c1
Sequence:CCGGTATTTCGCCAGGGTGATATTGCTCGAGCAATATCACCCTGGCGAAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007023.3-1733s21c1
Sequence:CCGGATACGCCTTGAGGCAACTTTACTCGAGTAAAGTTGCCTCAAGGCGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007023.3-2701s21c1
Sequence:CCGGCAAGCGTGTTCAGCTATTAAACTCGAGTTTAATAGCTGAACACGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)