EMAIL THIS PAGE TO A FRIEND

RAPSN

receptor-associated protein of the synapse

63 Gene Product Result for
Synonyms: RAPSYN RNF205
UniProtKB ID: Q13702, Q8TDF3, Q9BTD9
Gene ID:
Human(5913) Summary: This gene encodes a member of a family of proteins that are receptor associated proteins of the synapse. The encoded protein contains a conserved cAMP-dependent protein kinase phosphorylation site, and plays a critical role in clustering and anchoring nicotinic acetylcholine receptors at synaptic sites by linking the receptors to the underlying postsynaptic cytoskeleton, possibly by direct association with actin or spectrin. Mutations in this gene may play a role in postsynaptic congenital myasthenic syndromes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2011]
Mouse(19400) receptor-associated protein of the synapse
Rat(362161) receptor-associated protein of the synapse
Zebrafish(352942) receptor-associated protein of the synapse, 43kD
Horse(100051540) receptor-associated protein of the synapse
domestic cat(101095679) receptor-associated protein of the synapse
dog(609725) receptor-associated protein of the synapse
chicken(395986) receptor-associated protein of the synapse
cow(541061) receptor-associated protein of the synapse
sheep(101120016) receptor-associated protein of the synapse
naked mole-rat(101704924) receptor-associated protein of the synapse
Domestic Rabbit(100354253) receptor-associated protein of the synapse
domestic guinea pig(100729613) receptor-associated protein of the synapse
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005055 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005055 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005055 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009023 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009023 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009023 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065541 MISSION® esiRNA esiRNA human RAPSN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005055 Rosetta Predictions human pricing
NM_032645 Rosetta Predictions human pricing
NM_001108584 Rosetta Predictions rat pricing
NM_009023 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074393 predicted 730
2 SASI_Hs01_00074394 predicted 256
3 SASI_Hs01_00074395 predicted 655
4 SASI_Hs01_00074396 predicted 278
5 SASI_Hs01_00074397 predicted 720
6 SASI_Hs01_00074398 predicted 496
7 SASI_Hs01_00074399 predicted 771
8 SASI_Hs01_00074400 predicted 469
9 SASI_Hs01_00074401 predicted 370
10 SASI_Hs02_00338871 predicted 781
11 SASI_Hs01_00074402 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107663 predicted 728
2 SASI_Hs01_00107664 predicted 250
3 SASI_Hs01_00107665 predicted 659
4 SASI_Hs01_00107666 predicted 279
5 SASI_Hs01_00107667 predicted 721
6 SASI_Hs01_00107668 predicted 500
7 SASI_Hs01_00107669 predicted 769
8 SASI_Hs01_00107670 predicted 471
9 SASI_Hs01_00107671 predicted 368
10 SASI_Hs02_00360199 predicted 778
11 SASI_Hs01_00107672 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240079 predicted 398
2 SASI_Rn02_00240080 predicted 204
3 SASI_Rn02_00240081 predicted 366
4 SASI_Rn02_00240082 predicted 320
5 SASI_Rn02_00240083 predicted 908
6 SASI_Rn02_00240084 predicted 745
7 SASI_Rn02_00240085 predicted 435
8 SASI_Rn02_00240086 predicted 1074
9 SASI_Rn02_00240087 predicted 581
10 SASI_Rn02_00240088 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100018 predicted 285
2 SASI_Mm01_00100019 predicted 1112
3 SASI_Mm01_00100020 predicted 415
4 SASI_Mm01_00100021 predicted 394
5 SASI_Mm01_00100022 predicted 714
6 SASI_Mm01_00100023 predicted 442
7 SASI_Mm01_00100024 predicted 948
8 SASI_Mm01_00100025 predicted 1310
9 SASI_Mm01_00100026 predicted 1235
10 SASI_Mm01_00100027 predicted 323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005055
RAPSN MISSION shRNA Bacterial Glycerol Stock
receptor-associated protein of the synapse
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005055.3-287s21c1
Sequence:CCGGGCATTGCAGGTGTGGACAAAGCTCGAGCTTTGTCCACACCTGCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005055.3-1257s21c1
Sequence:CCGGACGTTGTGAGGTTCCACGAGTCTCGAGACTCGTGGAACCTCACAACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005055.3-738s21c1
Sequence:CCGGAGGTCAAGGACTACGAGAAAGCTCGAGCTTTCTCGTAGTCCTTGACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005055.3-1037s21c1
Sequence:CCGGATCATGACCGAGATCGGAAACCTCGAGGTTTCCGATCTCGGTCATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005055.3-782s1c1
Sequence:CCGGGCAGAGCTTGTCAACAACTATCTCGAGATAGTTGTTGACAAGCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005055.3-508s1c1
Sequence:CCGGGTTTCACAAGACCATCTCCTACTCGAGTAGGAGATGGTCTTGTGAAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005055.3-673s1c1
Sequence:CCGGCCACAACAATGATGACGCCATCTCGAGATGGCGTCATCATTGTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005055.3-1211s1c1
Sequence:CCGGGAGAGCATTTACCGCAGCAAACTCGAGTTTGCTGCGGTAAATGCTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005055.3-1506s1c1
Sequence:CCGGTGCACGCCAGAGGCCCATTTACTCGAGTAAATGGGCCTCTGGCGTGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005055
RAPSN MISSION shRNA shRNA Plasmid DNA
receptor-associated protein of the synapse
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005055.3-287s21c1
Sequence:CCGGGCATTGCAGGTGTGGACAAAGCTCGAGCTTTGTCCACACCTGCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005055.3-1257s21c1
Sequence:CCGGACGTTGTGAGGTTCCACGAGTCTCGAGACTCGTGGAACCTCACAACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005055.3-738s21c1
Sequence:CCGGAGGTCAAGGACTACGAGAAAGCTCGAGCTTTCTCGTAGTCCTTGACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005055.3-1037s21c1
Sequence:CCGGATCATGACCGAGATCGGAAACCTCGAGGTTTCCGATCTCGGTCATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005055.3-782s1c1
Sequence:CCGGGCAGAGCTTGTCAACAACTATCTCGAGATAGTTGTTGACAAGCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005055.3-508s1c1
Sequence:CCGGGTTTCACAAGACCATCTCCTACTCGAGTAGGAGATGGTCTTGTGAAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005055.3-673s1c1
Sequence:CCGGCCACAACAATGATGACGCCATCTCGAGATGGCGTCATCATTGTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005055.3-1211s1c1
Sequence:CCGGGAGAGCATTTACCGCAGCAAACTCGAGTTTGCTGCGGTAAATGCTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005055.3-1506s1c1
Sequence:CCGGTGCACGCCAGAGGCCCATTTACTCGAGTAAATGGGCCTCTGGCGTGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005055
RAPSN MISSION shRNA Lentiviral Transduction Particles
receptor-associated protein of the synapse
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005055.3-287s21c1
Sequence:CCGGGCATTGCAGGTGTGGACAAAGCTCGAGCTTTGTCCACACCTGCAATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000412450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005055.3-1257s21c1
Sequence:CCGGACGTTGTGAGGTTCCACGAGTCTCGAGACTCGTGGAACCTCACAACGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000424800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005055.3-738s21c1
Sequence:CCGGAGGTCAAGGACTACGAGAAAGCTCGAGCTTTCTCGTAGTCCTTGACCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000419649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005055.3-1037s21c1
Sequence:CCGGATCATGACCGAGATCGGAAACCTCGAGGTTTCCGATCTCGGTCATGATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005055.3-782s1c1
Sequence:CCGGGCAGAGCTTGTCAACAACTATCTCGAGATAGTTGTTGACAAGCTCTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005055.3-508s1c1
Sequence:CCGGGTTTCACAAGACCATCTCCTACTCGAGTAGGAGATGGTCTTGTGAAACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005055.3-673s1c1
Sequence:CCGGCCACAACAATGATGACGCCATCTCGAGATGGCGTCATCATTGTTGTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005055.3-1211s1c1
Sequence:CCGGGAGAGCATTTACCGCAGCAAACTCGAGTTTGCTGCGGTAAATGCTCTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005055.3-1506s1c1
Sequence:CCGGTGCACGCCAGAGGCCCATTTACTCGAGTAAATGGGCCTCTGGCGTGCATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009023
VALIDATED
RAPSN MISSION shRNA Bacterial Glycerol Stock
receptor-associated protein of the synapse
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009023.1-1408s1c1
Sequence:CCGGCCATCTTGGGTTTCCACACAACTCGAGTTGTGTGGAAACCCAAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009023.1-727s1c1
Sequence:CCGGGCAGAGCTTGTCAACGACTATCTCGAGATAGTCGTTGACAAGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009023.1-330s1c1
Sequence:CCGGCCGCTACAAAGAGATGCTGAACTCGAGTTCAGCATCTCTTTGTAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009023.1-1307s1c1
Sequence:CCGGCCCACATCTTTCATCTCAGATCTCGAGATCTGAGATGAAAGATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009023.1-732s1c1
Sequence:CCGGGCTTGTCAACGACTATGGCAACTCGAGTTGCCATAGTCGTTGACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009023
VALIDATED
RAPSN MISSION shRNA shRNA Plasmid DNA
receptor-associated protein of the synapse
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009023.1-1408s1c1
Sequence:CCGGCCATCTTGGGTTTCCACACAACTCGAGTTGTGTGGAAACCCAAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009023.1-727s1c1
Sequence:CCGGGCAGAGCTTGTCAACGACTATCTCGAGATAGTCGTTGACAAGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009023.1-330s1c1
Sequence:CCGGCCGCTACAAAGAGATGCTGAACTCGAGTTCAGCATCTCTTTGTAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009023.1-1307s1c1
Sequence:CCGGCCCACATCTTTCATCTCAGATCTCGAGATCTGAGATGAAAGATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009023.1-732s1c1
Sequence:CCGGGCTTGTCAACGACTATGGCAACTCGAGTTGCCATAGTCGTTGACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009023
VALIDATED
RAPSN MISSION shRNA Lentiviral Transduction Particles
receptor-associated protein of the synapse
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009023.1-1408s1c1
Sequence:CCGGCCATCTTGGGTTTCCACACAACTCGAGTTGTGTGGAAACCCAAGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000124020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009023.1-727s1c1
Sequence:CCGGGCAGAGCTTGTCAACGACTATCTCGAGATAGTCGTTGACAAGCTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000124021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009023.1-330s1c1
Sequence:CCGGCCGCTACAAAGAGATGCTGAACTCGAGTTCAGCATCTCTTTGTAGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000124023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009023.1-1307s1c1
Sequence:CCGGCCCACATCTTTCATCTCAGATCTCGAGATCTGAGATGAAAGATGTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000124022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009023.1-732s1c1
Sequence:CCGGGCTTGTCAACGACTATGGCAACTCGAGTTGCCATAGTCGTTGACAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???