EMAIL THIS PAGE TO A FRIEND

RARA

retinoic acid receptor, alpha

158 Gene Product Result for
Synonyms: NR1B1 RAR
Gene ID:
Human(5914) Summary: This gene represents a nuclear retinoic acid receptor. The encoded protein, retinoic acid receptor alpha, regulates transcription in a ligand-dependent manner. This gene has been implicated in regulation of development, differentiation, apoptosis, granulopoeisis, and transcription of clock genes. Translocations between this locus and several other loci have been associated with acute promyelocytic leukemia. Alternatively spliced transcript variants have been found for this locus.[provided by RefSeq, Sep 2010]
Mouse(19401) retinoic acid receptor, alpha
Rat(24705) retinoic acid receptor, alpha
chicken(395213) retinoic acid receptor, alpha
dog(480526) retinoic acid receptor, alpha
domestic cat(101083048) retinoic acid receptor, alpha
domestic guinea pig(100728220) retinoic acid receptor, alpha
naked mole-rat(101722948) retinoic acid receptor, alpha
cow(534280) retinoic acid receptor, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504659 Anti-phospho-Retinoic Acid Receptor α (pSer77) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1100358 Anti-RARA (13-25) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2500868 Anti-RARA antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1411972 ANTI-RARA antibody produced in mouse clone 1C10, purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, proximity ligation assay, western blot pricing
SAB1412190 ANTI-RARA antibody produced in mouse clone 4B3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AV40315 Anti-RARA antibody produced in rabbit IgG fraction of antiserum mouse, rat, human
western blot pricing
SAB2101946 Anti-RARA antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB2104010 Anti-RARA antibody produced in rabbit affinity isolated antibody canine, rabbit, mouse, human, rat
western blot pricing
HPA058282 Anti-RARA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4301581 Anti-Retinoic Acid Receptor A (Phospho-SER77) affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4502580 Anti-Retinoic Acid Receptor α antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4800047 Imprint® Anti-RARa antibody produced in rabbit whole antiserum, buffered aqueous solution human
ChIP, ELISA, western blot pricing
WH0005914M1 Monoclonal Anti-RARA antibody produced in mouse clone 2C9-1F8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404298 Monoclonal Anti-RARA antibody produced in mouse clone 2D2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
R3255 13-cis-Retinoic acid ≥98% (HPLC) human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
A8843 AM580 ≥98% (HPLC) human pricing
C5865 CD437 ≥98% (HPLC), solid human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
R4643 9-cis-Retinoic acid ≥98% (HPLC) human pricing
T3757 TTNPB human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
R2625 Retinoic acid ≥98% (HPLC), powder human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009024 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009024 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009024 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000964 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000964 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000964 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000964 Rosetta Predictions human pricing
NM_001024809 Rosetta Predictions human pricing
NM_001033603 Rosetta Predictions human pricing
NM_031528 Rosetta Predictions rat pricing
NM_009024 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231952 predicted 1084
2 SASI_Hs01_00231953 predicted 923
3 SASI_Hs01_00231954 predicted 1098
4 SASI_Hs01_00231955 predicted 1078
5 SASI_Hs01_00231956 predicted 908
6 SASI_Hs01_00231957 predicted 1027
7 SASI_Hs01_00231958 predicted 1025
8 SASI_Hs01_00231959 predicted 1277
9 SASI_Hs02_00303579 predicted 922
10 SASI_Hs01_00231960 predicted 1256
11 SASI_Hs01_00231961 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020481 predicted 1229
2 SASI_Hs01_00020482 predicted 1067
3 SASI_Hs01_00020483 predicted 1243
4 SASI_Hs01_00020484 predicted 1220
5 SASI_Hs01_00020485 predicted 1056
6 SASI_Hs01_00020486 predicted 1169
7 SASI_Hs01_00020487 predicted 1164
8 SASI_Hs01_00020488 predicted 1424
9 SASI_Hs02_00307250 predicted 1068
10 SASI_Hs01_00020489 predicted 1400
11 SASI_Hs01_00020490 predicted 1214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212481 predicted 1196
2 SASI_Hs01_00212482 predicted 1022
3 SASI_Hs01_00212483 predicted 1204
4 SASI_Hs01_00212484 predicted 1181
5 SASI_Hs01_00212485 predicted 1012
6 SASI_Hs01_00212486 predicted 1129
7 SASI_Hs01_00212487 predicted 1122
8 SASI_Hs01_00212488 predicted 1375
9 SASI_Hs01_00212489 predicted 1360
10 SASI_Hs01_00212490 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086405 predicted 1250
2 SASI_Rn01_00086406 predicted 602
3 SASI_Rn02_00264678 predicted 854
4 SASI_Rn01_00086407 predicted 1444
5 SASI_Rn01_00086408 predicted 905
6 SASI_Rn01_00086409 predicted 279
7 SASI_Rn01_00086410 predicted 840
8 SASI_Rn01_00086411 predicted 1290
9 SASI_Rn01_00086412 predicted 1620
10 SASI_Rn02_00264679 predicted 1304
11 SASI_Rn01_00086413 predicted 983
12 SASI_Rn01_00086414 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009024 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102474 predicted 796
2 SASI_Mm01_00102476 predicted 1472
3 SASI_Mm02_00315174 predicted 1025
4 SASI_Mm01_00102478 predicted 926
5 SASI_Mm01_00102479 predicted 1585
6 SASI_Mm01_00102480 predicted 1357
7 SASI_Mm01_00102481 predicted 695
8 SASI_Mm01_00102482 predicted 1202
9 SASI_Mm02_00315175 predicted 1014
10 SASI_Mm02_00315176 predicted 2145
11 SASI_Mm01_00102475 predicted 1274
12 SASI_Mm01_00102477 predicted 878
13 SASI_Mm01_00102483 predicted 541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009024
VALIDATED
RARA MISSION shRNA Bacterial Glycerol Stock
retinoic acid receptor, alpha
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009024.2-1808s21c1
Sequence:CCGGTGAGGGCTTGGACACTCTAAGCTCGAGCTTAGAGTGTCCAAGCCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009024.2-1622s21c1
Sequence:CCGGGCTGGAAGCACTGAAAGTCTACTCGAGTAGACTTTCAGTGCTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009024.2-1115s21c1
Sequence:CCGGGCTCATTGAGAAGGTTCGCAACTCGAGTTGCGAACCTTCTCAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009024.2-749s21c1
Sequence:CCGGGAGCAGCAGTTCCGAAGAGATCTCGAGATCTCTTCGGAACTGCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009024.2-2336s21c1
Sequence:CCGGGGGAGACTCCCTGTACATATCCTCGAGGATATGTACAGGGAGTCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009024.1-1479s1c1
Sequence:CCGGCTGAAAGTCTACGTCCGGAAACTCGAGTTTCCGGACGTAGACTTTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009024.1-962s1c1
Sequence:CCGGGCTCATTGAGAAGGTTCGCAACTCGAGTTGCGAACCTTCTCAATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009024.1-677s1c1
Sequence:CCGGTCAAGACAAATCATCCGGCTACTCGAGTAGCCGGATGATTTGTCTTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009024.1-740s1c1
Sequence:CCGGCCGACGAAGCATCCAGAAGAACTCGAGTTCTTCTGGATGCTTCGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009024.1-1536s1c1
Sequence:CCGGCTGATGAAGATCACAGACCTTCTCGAGAAGGTCTGTGATCTTCATCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009024.1-842s1c1
Sequence:CCGGGAAATGTTTCGACGTGGGCATCTCGAGATGCCCACGTCGAAACATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009024.1-1469s1c1
Sequence:CCGGGCTGGAAGCACTGAAAGTCTACTCGAGTAGACTTTCAGTGCTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009024.1-876s1c1
Sequence:CCGGGTGCGAAACGATCGAAAGAAACTCGAGTTTCTTTCGATCGTTTCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009024.1-596s1c1
Sequence:CCGGGAGCAGCAGTTCCGAAGAGATCTCGAGATCTCTTCGGAACTGCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009024.1-1248s1c1
Sequence:CCGGGACACACTGACCTTCTCAGATCTCGAGATCTGAGAAGGTCAGTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009024
VALIDATED
RARA MISSION shRNA shRNA Plasmid DNA
retinoic acid receptor, alpha
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009024.2-1808s21c1
Sequence:CCGGTGAGGGCTTGGACACTCTAAGCTCGAGCTTAGAGTGTCCAAGCCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009024.2-1622s21c1
Sequence:CCGGGCTGGAAGCACTGAAAGTCTACTCGAGTAGACTTTCAGTGCTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009024.2-1115s21c1
Sequence:CCGGGCTCATTGAGAAGGTTCGCAACTCGAGTTGCGAACCTTCTCAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009024.2-749s21c1
Sequence:CCGGGAGCAGCAGTTCCGAAGAGATCTCGAGATCTCTTCGGAACTGCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009024.2-2336s21c1
Sequence:CCGGGGGAGACTCCCTGTACATATCCTCGAGGATATGTACAGGGAGTCTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009024.1-1479s1c1
Sequence:CCGGCTGAAAGTCTACGTCCGGAAACTCGAGTTTCCGGACGTAGACTTTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009024.1-962s1c1
Sequence:CCGGGCTCATTGAGAAGGTTCGCAACTCGAGTTGCGAACCTTCTCAATGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009024.1-677s1c1
Sequence:CCGGTCAAGACAAATCATCCGGCTACTCGAGTAGCCGGATGATTTGTCTTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009024.1-740s1c1
Sequence:CCGGCCGACGAAGCATCCAGAAGAACTCGAGTTCTTCTGGATGCTTCGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009024.1-1536s1c1
Sequence:CCGGCTGATGAAGATCACAGACCTTCTCGAGAAGGTCTGTGATCTTCATCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009024.1-842s1c1
Sequence:CCGGGAAATGTTTCGACGTGGGCATCTCGAGATGCCCACGTCGAAACATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009024.1-1469s1c1
Sequence:CCGGGCTGGAAGCACTGAAAGTCTACTCGAGTAGACTTTCAGTGCTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009024.1-876s1c1
Sequence:CCGGGTGCGAAACGATCGAAAGAAACTCGAGTTTCTTTCGATCGTTTCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009024.1-596s1c1
Sequence:CCGGGAGCAGCAGTTCCGAAGAGATCTCGAGATCTCTTCGGAACTGCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009024.1-1248s1c1
Sequence:CCGGGACACACTGACCTTCTCAGATCTCGAGATCTGAGAAGGTCAGTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009024
VALIDATED
RARA MISSION shRNA Lentiviral Transduction Particles
retinoic acid receptor, alpha
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009024.2-1808s21c1
Sequence:CCGGTGAGGGCTTGGACACTCTAAGCTCGAGCTTAGAGTGTCCAAGCCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009024.2-1622s21c1
Sequence:CCGGGCTGGAAGCACTGAAAGTCTACTCGAGTAGACTTTCAGTGCTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009024.2-1115s21c1
Sequence:CCGGGCTCATTGAGAAGGTTCGCAACTCGAGTTGCGAACCTTCTCAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009024.2-749s21c1
Sequence:CCGGGAGCAGCAGTTCCGAAGAGATCTCGAGATCTCTTCGGAACTGCTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009024.2-2336s21c1
Sequence:CCGGGGGAGACTCCCTGTACATATCCTCGAGGATATGTACAGGGAGTCTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009024.1-1479s1c1
Sequence:CCGGCTGAAAGTCTACGTCCGGAAACTCGAGTTTCCGGACGTAGACTTTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009024.1-962s1c1
Sequence:CCGGGCTCATTGAGAAGGTTCGCAACTCGAGTTGCGAACCTTCTCAATGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009024.1-677s1c1
Sequence:CCGGTCAAGACAAATCATCCGGCTACTCGAGTAGCCGGATGATTTGTCTTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009024.1-740s1c1
Sequence:CCGGCCGACGAAGCATCCAGAAGAACTCGAGTTCTTCTGGATGCTTCGTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009024.1-1536s1c1
Sequence:CCGGCTGATGAAGATCACAGACCTTCTCGAGAAGGTCTGTGATCTTCATCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009024.1-842s1c1
Sequence:CCGGGAAATGTTTCGACGTGGGCATCTCGAGATGCCCACGTCGAAACATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009024.1-1469s1c1
Sequence:CCGGGCTGGAAGCACTGAAAGTCTACTCGAGTAGACTTTCAGTGCTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009024.1-876s1c1
Sequence:CCGGGTGCGAAACGATCGAAAGAAACTCGAGTTTCTTTCGATCGTTTCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009024.1-596s1c1
Sequence:CCGGGAGCAGCAGTTCCGAAGAGATCTCGAGATCTCTTCGGAACTGCTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009024.1-1248s1c1
Sequence:CCGGGACACACTGACCTTCTCAGATCTCGAGATCTGAGAAGGTCAGTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000964
VALIDATED
RARA MISSION shRNA Bacterial Glycerol Stock
retinoic acid receptor, alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285401    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000964.2-2334s21c1
Sequence:CCGGGGTATTAATTCTCGCTGGTTTCTCGAGAAACCAGCGAGAATTAATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000964.2-1015s21c1
Sequence:CCGGTCATTGAGAAGGTGCGCAAAGCTCGAGCTTTGCGCACCTTCTCAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000964.2-594s21c1
Sequence:CCGGCAGCTTCCAGTTAGTGGATATCTCGAGATATCCACTAACTGGAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000964.2-1118s21c1
Sequence:CCGGCATTGACCTCTGGGACAAGTTCTCGAGAACTTGTCCCAGAGGTCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000964.2-1578s21c1
Sequence:CCGGCCCAAGATGCTAATGAAGATTCTCGAGAATCTTCATTAGCATCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000964.1-1225s1c1
Sequence:CCGGCCCAAGATGCTAATGAAGATTCTCGAGAATCTTCATTAGCATCTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000964.1-241s1c1
Sequence:CCGGCAGCTTCCAGTTAGTGGATATCTCGAGATATCCACTAACTGGAAGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000964.1-570s1c1
Sequence:CCGGGTCTGTGAGAAACGACCGAAACTCGAGTTTCGGTCGTTTCTCACAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000964.1-349s1c1
Sequence:CCGGCGCATCTACAAGCCTTGCTTTCTCGAGAAAGCAAGGCTTGTAGATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000964
VALIDATED
RARA MISSION shRNA shRNA Plasmid DNA
retinoic acid receptor, alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285401    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000964.2-2334s21c1
Sequence:CCGGGGTATTAATTCTCGCTGGTTTCTCGAGAAACCAGCGAGAATTAATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000964.2-1015s21c1
Sequence:CCGGTCATTGAGAAGGTGCGCAAAGCTCGAGCTTTGCGCACCTTCTCAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000964.2-594s21c1
Sequence:CCGGCAGCTTCCAGTTAGTGGATATCTCGAGATATCCACTAACTGGAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000964.2-1118s21c1
Sequence:CCGGCATTGACCTCTGGGACAAGTTCTCGAGAACTTGTCCCAGAGGTCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000964.2-1578s21c1
Sequence:CCGGCCCAAGATGCTAATGAAGATTCTCGAGAATCTTCATTAGCATCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000964.1-1225s1c1
Sequence:CCGGCCCAAGATGCTAATGAAGATTCTCGAGAATCTTCATTAGCATCTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000964.1-241s1c1
Sequence:CCGGCAGCTTCCAGTTAGTGGATATCTCGAGATATCCACTAACTGGAAGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000964.1-570s1c1
Sequence:CCGGGTCTGTGAGAAACGACCGAAACTCGAGTTTCGGTCGTTTCTCACAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000964.1-349s1c1
Sequence:CCGGCGCATCTACAAGCCTTGCTTTCTCGAGAAAGCAAGGCTTGTAGATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000964
VALIDATED
RARA MISSION shRNA Lentiviral Transduction Particles
retinoic acid receptor, alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285401    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000964.2-2334s21c1
Sequence:CCGGGGTATTAATTCTCGCTGGTTTCTCGAGAAACCAGCGAGAATTAATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000964.2-1015s21c1
Sequence:CCGGTCATTGAGAAGGTGCGCAAAGCTCGAGCTTTGCGCACCTTCTCAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000964.2-594s21c1
Sequence:CCGGCAGCTTCCAGTTAGTGGATATCTCGAGATATCCACTAACTGGAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000964.2-1118s21c1
Sequence:CCGGCATTGACCTCTGGGACAAGTTCTCGAGAACTTGTCCCAGAGGTCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000964.2-1578s21c1
Sequence:CCGGCCCAAGATGCTAATGAAGATTCTCGAGAATCTTCATTAGCATCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000964.1-1225s1c1
Sequence:CCGGCCCAAGATGCTAATGAAGATTCTCGAGAATCTTCATTAGCATCTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000964.1-241s1c1
Sequence:CCGGCAGCTTCCAGTTAGTGGATATCTCGAGATATCCACTAACTGGAAGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000964.1-570s1c1
Sequence:CCGGGTCTGTGAGAAACGACCGAAACTCGAGTTTCGGTCGTTTCTCACAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000964.1-349s1c1
Sequence:CCGGCGCATCTACAAGCCTTGCTTTCTCGAGAAAGCAAGGCTTGTAGATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)