EMAIL THIS PAGE TO A FRIEND

RARB

retinoic acid receptor, beta

208 Gene Product Result for
Synonyms: HAP NR1B2 RRB2
UniProtKB ID: P10826, P12891, Q00989, Q15298, Q9UN48
Gene ID:
Human(5915) Summary: This gene encodes retinoic acid receptor beta, a member of the thyroid-steroid hormone receptor superfamily of nuclear transcriptional regulators. This receptor localizes to the cytoplasm and to subnuclear compartments. It binds retinoic acid, the biologically active form of vitamin A which mediates cellular signalling in embryonic morphogenesis, cell growth and differentiation. It is thought that this protein limits growth of many cell types by regulating gene expression. The gene was first identified in a hepatocellular carcinoma where it flanks a hepatitis B virus integration site. The gene expresses at least two transcript variants; one additional transcript has been described, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(218772) retinoic acid receptor, beta
Rat(24706) retinoic acid receptor, beta
Domestic Rabbit(100358445) retinoic acid receptor, beta
naked mole-rat(101724485) retinoic acid receptor, beta
domestic guinea pig(100379264) retinoic acid receptor, beta
cow(616895) retinoic acid receptor, beta
sheep(101122663) retinoic acid receptor, beta
chicken(396266) retinoic acid receptor, beta
Horse(100051546) retinoic acid receptor, beta
domestic cat(101085742) retinoic acid receptor, beta
dog(477045) retinoic acid receptor, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
C5865 CD437 ≥98% (HPLC), solid human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
R4643 9-cis-Retinoic acid ≥98% (HPLC) human pricing
T3757 TTNPB human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
R2625 Retinoic acid ≥98% (HPLC), powder human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000965 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011243 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011243 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011243 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000965 Rosetta Predictions human pricing
NM_016152 Rosetta Predictions human pricing
XM_001059459 Rosetta Predictions rat pricing
XM_001059523 Rosetta Predictions rat pricing
XM_223843 Rosetta Predictions rat pricing
NM_011243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062416 predicted 1501
2 SASI_Hs01_00062417 predicted 1551
3 SASI_Hs01_00062418 predicted 825
4 SASI_Hs01_00062419 predicted 973
5 SASI_Hs01_00062420 predicted 1652
6 SASI_Hs01_00062421 predicted 1298
7 SASI_Hs01_00062422 predicted 1366
8 SASI_Hs02_00303580 predicted 1685
9 SASI_Hs01_00062423 predicted 1249
10 SASI_Hs01_00062424 predicted 1149
11 SASI_Hs01_00062425 predicted 1852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237846 predicted 1149
2 SASI_Hs01_00237847 predicted 1195
3 SASI_Hs01_00237848 predicted 472
4 SASI_Hs01_00237849 predicted 619
5 SASI_Hs01_00237850 predicted 1298
6 SASI_Hs01_00237851 predicted 935
7 SASI_Hs01_00237852 predicted 1007
8 SASI_Hs02_00348955 predicted 1325
9 SASI_Hs01_00237853 predicted 897
10 SASI_Hs01_00237854 predicted 784
11 SASI_Hs01_00237855 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293275 predicted 503
2 SASI_Rn02_00293276 predicted 1409
3 SASI_Rn02_00293277 predicted 505
4 SASI_Rn02_00293278 predicted 470
5 SASI_Rn02_00293279 predicted 1243
6 SASI_Rn02_00293280 predicted 1296
7 SASI_Rn02_00293281 predicted 464
8 SASI_Rn02_00293282 predicted 933
9 SASI_Rn02_00293283 predicted 1195
10 SASI_Rn02_00293284 predicted 1585
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293489 predicted 1173
2 SASI_Rn02_00293490 predicted 2074
3 SASI_Rn02_00293491 predicted 1171
4 SASI_Rn02_00293492 predicted 1130
5 SASI_Rn02_00293493 predicted 1901
6 SASI_Rn02_00293494 predicted 1959
7 SASI_Rn02_00293495 predicted 1597
8 SASI_Rn02_00293496 predicted 1862
9 SASI_Rn02_00293497 predicted 1320
10 SASI_Rn02_00293498 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381720 predicted 1005
2 SASI_Rn02_00381721 predicted 1287
3 SASI_Rn02_00381722 predicted 834
4 SASI_Rn02_00381723 predicted 1239
5 SASI_Rn02_00381724 predicted 885
6 SASI_Rn02_00381725 predicted 1281
7 SASI_Rn02_00381726 predicted 522
8 SASI_Rn02_00381727 predicted 790
9 SASI_Rn02_00381728 predicted 1172
10 SASI_Rn02_00381729 predicted 1300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194925 predicted 545
2 SASI_Mm01_00194926 predicted 1339
3 SASI_Mm01_00194927 predicted 526
4 SASI_Mm01_00194928 predicted 642
5 SASI_Mm02_00320231 predicted 528
6 SASI_Mm01_00194929 predicted 1284
7 SASI_Mm01_00194930 predicted 1395
8 SASI_Mm01_00194931 predicted 1245
9 SASI_Mm01_00194934 predicted 1543
10 SASI_Mm02_00320232 predicted 1630
11 SASI_Mm01_00194932 predicted 987
12 SASI_Mm01_00194933 predicted 564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000965
RARB MISSION shRNA Bacterial Glycerol Stock
retinoic acid receptor, beta
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000965.3-1227s21c1
Sequence:CCGGTCAGACGGCCTTACCCTAAATCTCGAGATTTAGGGTAAGGCCGTCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000965.2-1246s1c1
Sequence:CCGGGACATCCTGATTCTTAGAATTCTCGAGAATTCTAAGAATCAGGATGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000965.2-575s1c1
Sequence:CCGGGCTTCAGTGGATTGACCCAAACTCGAGTTTGGGTCAATCCACTGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000965.2-1665s1c1
Sequence:CCGGGCCACCTCTCATTCAAGAAATCTCGAGATTTCTTGAATGAGAGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000965.2-1060s1c1
Sequence:CCGGCTGGGTAAATACACCACGAATCTCGAGATTCGTGGTGTATTTACCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000965
RARB MISSION shRNA shRNA Plasmid DNA
retinoic acid receptor, beta
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000965.3-1227s21c1
Sequence:CCGGTCAGACGGCCTTACCCTAAATCTCGAGATTTAGGGTAAGGCCGTCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000965.2-1246s1c1
Sequence:CCGGGACATCCTGATTCTTAGAATTCTCGAGAATTCTAAGAATCAGGATGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000965.2-575s1c1
Sequence:CCGGGCTTCAGTGGATTGACCCAAACTCGAGTTTGGGTCAATCCACTGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000965.2-1665s1c1
Sequence:CCGGGCCACCTCTCATTCAAGAAATCTCGAGATTTCTTGAATGAGAGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000965.2-1060s1c1
Sequence:CCGGCTGGGTAAATACACCACGAATCTCGAGATTCGTGGTGTATTTACCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000965
RARB MISSION shRNA Lentiviral Transduction Particles
retinoic acid receptor, beta
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000965.3-1227s21c1
Sequence:CCGGTCAGACGGCCTTACCCTAAATCTCGAGATTTAGGGTAAGGCCGTCTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000965.2-1246s1c1
Sequence:CCGGGACATCCTGATTCTTAGAATTCTCGAGAATTCTAAGAATCAGGATGTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000965.2-575s1c1
Sequence:CCGGGCTTCAGTGGATTGACCCAAACTCGAGTTTGGGTCAATCCACTGAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000965.2-1665s1c1
Sequence:CCGGGCCACCTCTCATTCAAGAAATCTCGAGATTTCTTGAATGAGAGGTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000965.2-1060s1c1
Sequence:CCGGCTGGGTAAATACACCACGAATCTCGAGATTCGTGGTGTATTTACCCAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011243
RARB MISSION shRNA Bacterial Glycerol Stock
retinoic acid receptor, beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011243.1-630s1c1
Sequence:CCGGGCATGTCCAAAGAGTCTGTTACTCGAGTAACAGACTCTTTGGACATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011243.1-1448s1c1
Sequence:CCGGCCAAGTTCAAGTGGGAATATACTCGAGTATATTCCCACTTGAACTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011243.1-1351s1c1
Sequence:CCGGCGAACGTGTAATTACCTTGAACTCGAGTTCAAGGTAATTACACGTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011243.1-551s1c1
Sequence:CCGGCGAGATAAGAACTGCGTCATTCTCGAGAATGACGCAGTTCTTATCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011243.1-511s1c1
Sequence:CCGGCCGCAGAAGTATTCAGAAGAACTCGAGTTCTTCTGAATACTTCTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011243
RARB MISSION shRNA shRNA Plasmid DNA
retinoic acid receptor, beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011243.1-630s1c1
Sequence:CCGGGCATGTCCAAAGAGTCTGTTACTCGAGTAACAGACTCTTTGGACATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011243.1-1448s1c1
Sequence:CCGGCCAAGTTCAAGTGGGAATATACTCGAGTATATTCCCACTTGAACTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011243.1-1351s1c1
Sequence:CCGGCGAACGTGTAATTACCTTGAACTCGAGTTCAAGGTAATTACACGTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011243.1-551s1c1
Sequence:CCGGCGAGATAAGAACTGCGTCATTCTCGAGAATGACGCAGTTCTTATCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011243.1-511s1c1
Sequence:CCGGCCGCAGAAGTATTCAGAAGAACTCGAGTTCTTCTGAATACTTCTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011243
RARB MISSION shRNA Lentiviral Transduction Particles
retinoic acid receptor, beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011243.1-630s1c1
Sequence:CCGGGCATGTCCAAAGAGTCTGTTACTCGAGTAACAGACTCTTTGGACATGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011243.1-1448s1c1
Sequence:CCGGCCAAGTTCAAGTGGGAATATACTCGAGTATATTCCCACTTGAACTTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011243.1-1351s1c1
Sequence:CCGGCGAACGTGTAATTACCTTGAACTCGAGTTCAAGGTAATTACACGTTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011243.1-551s1c1
Sequence:CCGGCGAGATAAGAACTGCGTCATTCTCGAGAATGACGCAGTTCTTATCTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011243.1-511s1c1
Sequence:CCGGCCGCAGAAGTATTCAGAAGAACTCGAGTTCTTCTGAATACTTCTGCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)