EMAIL THIS PAGE TO A FRIEND

RARG

retinoic acid receptor, gamma

210 Gene Product Result for
Synonyms: NR1B3 RARC
Gene ID:
Human(5916) Summary: This gene encodes a retinoic acid receptor that belongs to the nuclear hormone receptor family. Retinoic acid receptors (RARs) act as ligand-dependent transcriptional regulators. When bound to ligands, RARs activate transcription by binding as heterodimers to the retinoic acid response elements (RARE) found in the promoter regions of the target genes. In their unbound form, RARs repress transcription of their target genes. RARs are involved in various biological processes, including limb bud development, skeletal growth, and matrix homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(19411) retinoic acid receptor, gamma
Rat(685072) retinoic acid receptor, gamma
cow(540425) retinoic acid receptor, gamma
sheep(101106414) retinoic acid receptor, gamma
domestic guinea pig(100733817) retinoic acid receptor, gamma
naked mole-rat(101722573) retinoic acid receptor, gamma
dog(486508) retinoic acid receptor, gamma
domestic cat(101083275) retinoic acid receptor, gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
C5865 CD437 ≥98% (HPLC), solid human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
R4643 9-cis-Retinoic acid ≥98% (HPLC) human pricing
T3757 TTNPB human pricing
R2625 Retinoic acid ≥98% (HPLC), powder human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011244 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011244 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011244 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000966 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000966 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000966 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000966 siRNAs that have been validated in the lab human pricing
NM_001042728 Rosetta Predictions human pricing
XM_001062412 Rosetta Predictions rat pricing
XM_001062469 Rosetta Predictions rat pricing
XM_001062528 Rosetta Predictions rat pricing
NM_001042727 Rosetta Predictions mouse pricing
NM_011244 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000966 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012456 validated 694
1 SASI_Hs01_00012455 validated 1177
1 SASI_Hs01_00012454 validated 2209
2 SASI_Hs02_00303581 predicted 2267
3 SASI_Hs02_00303582 predicted 1057
4 SASI_Hs02_00303583 predicted 2085
5 SASI_Hs02_00303584 predicted 1405
6 SASI_Hs02_00303585 predicted 1734
7 SASI_Hs01_00012457 predicted 950
8 SASI_Hs02_00303586 predicted 1238
9 SASI_Hs02_00303587 predicted 2133
10 SASI_Hs02_00303588 predicted 1721
11 SASI_Hs01_00012458 predicted 915
12 SASI_Hs01_00012459 predicted 941
13 SASI_Hs01_00012460 predicted 1607
14 SASI_Hs01_00012461 predicted 906
15 SASI_Hs01_00012462 predicted 960
16 SASI_Hs01_00012463 predicted 1907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311099 predicted 2016
2 SASI_Hs02_00311100 predicted 814
3 SASI_Hs02_00311101 predicted 1832
4 SASI_Hs02_00311102 predicted 929
5 SASI_Hs02_00311103 predicted 1155
6 SASI_Hs02_00311104 predicted 1481
7 SASI_Hs02_00311105 predicted 699
8 SASI_Hs02_00311106 predicted 992
9 SASI_Hs02_00311107 predicted 1878
10 SASI_Hs02_00311108 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062412 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303383 predicted 565
2 SASI_Rn02_00303384 predicted 1783
3 SASI_Rn02_00303385 predicted 1119
4 SASI_Rn02_00303386 predicted 1382
5 SASI_Rn02_00303387 predicted 826
6 SASI_Rn02_00303388 predicted 1849
7 SASI_Rn02_00303389 predicted 1492
8 SASI_Rn02_00303390 predicted 955
9 SASI_Rn02_00303391 predicted 315
10 SASI_Rn02_00303392 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062469 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303527 predicted 1087
2 SASI_Rn02_00303528 predicted 2309
3 SASI_Rn02_00303529 predicted 1647
4 SASI_Rn02_00303530 predicted 1910
5 SASI_Rn02_00303531 predicted 1350
6 SASI_Rn02_00303532 predicted 2375
7 SASI_Rn02_00303533 predicted 2020
8 SASI_Rn02_00303534 predicted 969
9 SASI_Rn02_00303535 predicted 1485
10 SASI_Rn02_00303536 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303752 predicted 742
2 SASI_Rn02_00303753 predicted 1954
3 SASI_Rn02_00303754 predicted 1292
4 SASI_Rn02_00303755 predicted 1554
5 SASI_Rn02_00303756 predicted 999
6 SASI_Rn02_00303757 predicted 2025
7 SASI_Rn02_00303758 predicted 1667
8 SASI_Rn02_00303759 predicted 1134
9 SASI_Rn02_00303760 predicted 497
10 SASI_Rn02_00303761 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291075 predicted 1290
2 SASI_Mm02_00291076 predicted 590
3 SASI_Mm02_00291077 predicted 1617
4 SASI_Mm02_00291078 predicted 918
5 SASI_Mm02_00291079 predicted 642
6 SASI_Mm02_00291080 predicted 1357
7 SASI_Mm02_00291081 predicted 860
8 SASI_Mm02_00291082 predicted 563
9 SASI_Mm02_00291083 predicted 566
10 SASI_Mm02_00291084 predicted 1512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320233 predicted 1638
2 SASI_Mm02_00320234 predicted 928
3 SASI_Mm01_00105343 predicted 1967
4 SASI_Mm01_00105345 predicted 1266
5 SASI_Mm01_00105346 predicted 985
6 SASI_Mm01_00105349 predicted 1705
7 SASI_Mm02_00320235 predicted 1210
8 SASI_Mm01_00105350 predicted 916
9 SASI_Mm01_00105351 predicted 917
10 SASI_Mm01_00105352 predicted 1859
11 SASI_Mm01_00105344 predicted 508
12 SASI_Mm01_00105347 predicted 1357
13 SASI_Mm01_00105348 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011244
VALIDATED
RARG MISSION shRNA Bacterial Glycerol Stock
retinoic acid receptor, gamma
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011244.2-531s1c1
Sequence:CCGGCAATGACAAGTCTTCTGGCTACTCGAGTAGCCAGAAGACTTGTCATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011244.2-1011s1c1
Sequence:CCGGGCTCAGCATTGCCGACCAGATCTCGAGATCTGGTCGGCAATGCTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011244.2-365s1c1
Sequence:CCGGCATTTGAGATGCTGAGCCCTACTCGAGTAGGGCTCAGCATCTCAAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011244.2-505s1c1
Sequence:CCGGCGGGTCTATAAGCCATGCTTTCTCGAGAAAGCATGGCTTATAGACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011244.3-1274s21c1
Sequence:CCGGTGCGGATCTGTACAAGGTATACTCGAGTATACCTTGTACAGATCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011244.2-1427s1c1
Sequence:CCGGAGGGAGCAGAAAGGGCTATAACTCGAGTTATAGCCCTTTCTGCTCCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011244.3-1300s21c1
Sequence:CCGGGAGCAGGACACTATGACATTCCTCGAGGAATGTCATAGTGTCCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011244.3-1215s21c1
Sequence:CCGGGCTCAGCATTGCCGACCAGATCTCGAGATCTGGTCGGCAATGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011244.3-1251s21c1
Sequence:CCGGTGCTTGTCTGGACATCCTAATCTCGAGATTAGGATGTCCAGACAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011244.3-2062s21c1
Sequence:CCGGAGCCTGGGTCTAGACTCTAAACTCGAGTTTAGAGTCTAGACCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011244
VALIDATED
RARG MISSION shRNA shRNA Plasmid DNA
retinoic acid receptor, gamma
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011244.2-531s1c1
Sequence:CCGGCAATGACAAGTCTTCTGGCTACTCGAGTAGCCAGAAGACTTGTCATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011244.2-1011s1c1
Sequence:CCGGGCTCAGCATTGCCGACCAGATCTCGAGATCTGGTCGGCAATGCTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011244.2-365s1c1
Sequence:CCGGCATTTGAGATGCTGAGCCCTACTCGAGTAGGGCTCAGCATCTCAAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011244.2-505s1c1
Sequence:CCGGCGGGTCTATAAGCCATGCTTTCTCGAGAAAGCATGGCTTATAGACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011244.3-1274s21c1
Sequence:CCGGTGCGGATCTGTACAAGGTATACTCGAGTATACCTTGTACAGATCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011244.2-1427s1c1
Sequence:CCGGAGGGAGCAGAAAGGGCTATAACTCGAGTTATAGCCCTTTCTGCTCCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011244.3-1300s21c1
Sequence:CCGGGAGCAGGACACTATGACATTCCTCGAGGAATGTCATAGTGTCCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011244.3-1215s21c1
Sequence:CCGGGCTCAGCATTGCCGACCAGATCTCGAGATCTGGTCGGCAATGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011244.3-1251s21c1
Sequence:CCGGTGCTTGTCTGGACATCCTAATCTCGAGATTAGGATGTCCAGACAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011244.3-2062s21c1
Sequence:CCGGAGCCTGGGTCTAGACTCTAAACTCGAGTTTAGAGTCTAGACCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011244
VALIDATED
RARG MISSION shRNA Lentiviral Transduction Particles
retinoic acid receptor, gamma
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011244.2-531s1c1
Sequence:CCGGCAATGACAAGTCTTCTGGCTACTCGAGTAGCCAGAAGACTTGTCATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011244.2-1011s1c1
Sequence:CCGGGCTCAGCATTGCCGACCAGATCTCGAGATCTGGTCGGCAATGCTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011244.2-365s1c1
Sequence:CCGGCATTTGAGATGCTGAGCCCTACTCGAGTAGGGCTCAGCATCTCAAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011244.2-505s1c1
Sequence:CCGGCGGGTCTATAAGCCATGCTTTCTCGAGAAAGCATGGCTTATAGACCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011244.3-1274s21c1
Sequence:CCGGTGCGGATCTGTACAAGGTATACTCGAGTATACCTTGTACAGATCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011244.2-1427s1c1
Sequence:CCGGAGGGAGCAGAAAGGGCTATAACTCGAGTTATAGCCCTTTCTGCTCCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011244.3-1300s21c1
Sequence:CCGGGAGCAGGACACTATGACATTCCTCGAGGAATGTCATAGTGTCCTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011244.3-1215s21c1
Sequence:CCGGGCTCAGCATTGCCGACCAGATCTCGAGATCTGGTCGGCAATGCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011244.3-1251s21c1
Sequence:CCGGTGCTTGTCTGGACATCCTAATCTCGAGATTAGGATGTCCAGACAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011244.3-2062s21c1
Sequence:CCGGAGCCTGGGTCTAGACTCTAAACTCGAGTTTAGAGTCTAGACCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000966
VALIDATED
RARG MISSION shRNA Bacterial Glycerol Stock
retinoic acid receptor, gamma
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000966.3-1245s1c1
Sequence:CCGGGCTGCGTATCTGCACAAGGTACTCGAGTACCTTGTGCAGATACGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000966.3-1653s1c1
Sequence:CCGGGCCTCCCTTAATCCGAGAGATCTCGAGATCTCTCGGATTAAGGGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000966.3-708s1c1
Sequence:CCGGCAATGACAAGTCCTCTGGCTACTCGAGTAGCCAGAGGACTTGTCATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000966.3-978s1c1
Sequence:CCGGCCCTCAGTTAGAAGAGCTCATCTCGAGATGAGCTCTTCTAACTGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000966.4-1096s21c1
Sequence:CCGGTCTGCCAGCTGGGCAAGTATACTCGAGTATACTTGCCCAGCTGGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000966.4-2672s21c1
Sequence:CCGGCCCAGAGGAAGCCTCTATTTACTCGAGTAAATAGAGGCTTCCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000966.4-1727s21c1
Sequence:CCGGGATGCTGGAGAACCCTGAAATCTCGAGATTTCAGGGTTCTCCAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000966.4-963s21c1
Sequence:CCGGGTGCGAAATGACCGGAACAAGCTCGAGCTTGTTCCGGTCATTTCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000966.4-1274s21c1
Sequence:CCGGCAAAGCTGCCTGCCTAGATATCTCGAGATATCTAGGCAGGCAGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000966
VALIDATED
RARG MISSION shRNA shRNA Plasmid DNA
retinoic acid receptor, gamma
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000966.3-1245s1c1
Sequence:CCGGGCTGCGTATCTGCACAAGGTACTCGAGTACCTTGTGCAGATACGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000966.3-1653s1c1
Sequence:CCGGGCCTCCCTTAATCCGAGAGATCTCGAGATCTCTCGGATTAAGGGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000966.3-708s1c1
Sequence:CCGGCAATGACAAGTCCTCTGGCTACTCGAGTAGCCAGAGGACTTGTCATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000966.3-978s1c1
Sequence:CCGGCCCTCAGTTAGAAGAGCTCATCTCGAGATGAGCTCTTCTAACTGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000966.4-1096s21c1
Sequence:CCGGTCTGCCAGCTGGGCAAGTATACTCGAGTATACTTGCCCAGCTGGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000966.4-2672s21c1
Sequence:CCGGCCCAGAGGAAGCCTCTATTTACTCGAGTAAATAGAGGCTTCCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000966.4-1727s21c1
Sequence:CCGGGATGCTGGAGAACCCTGAAATCTCGAGATTTCAGGGTTCTCCAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000966.4-963s21c1
Sequence:CCGGGTGCGAAATGACCGGAACAAGCTCGAGCTTGTTCCGGTCATTTCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000966.4-1274s21c1
Sequence:CCGGCAAAGCTGCCTGCCTAGATATCTCGAGATATCTAGGCAGGCAGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000966
VALIDATED
RARG MISSION shRNA Lentiviral Transduction Particles
retinoic acid receptor, gamma
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000966.3-1245s1c1
Sequence:CCGGGCTGCGTATCTGCACAAGGTACTCGAGTACCTTGTGCAGATACGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000966.3-1653s1c1
Sequence:CCGGGCCTCCCTTAATCCGAGAGATCTCGAGATCTCTCGGATTAAGGGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000966.3-708s1c1
Sequence:CCGGCAATGACAAGTCCTCTGGCTACTCGAGTAGCCAGAGGACTTGTCATTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000966.3-978s1c1
Sequence:CCGGCCCTCAGTTAGAAGAGCTCATCTCGAGATGAGCTCTTCTAACTGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000966.4-1096s21c1
Sequence:CCGGTCTGCCAGCTGGGCAAGTATACTCGAGTATACTTGCCCAGCTGGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000966.4-2672s21c1
Sequence:CCGGCCCAGAGGAAGCCTCTATTTACTCGAGTAAATAGAGGCTTCCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000966.4-1727s21c1
Sequence:CCGGGATGCTGGAGAACCCTGAAATCTCGAGATTTCAGGGTTCTCCAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000966.4-963s21c1
Sequence:CCGGGTGCGAAATGACCGGAACAAGCTCGAGCTTGTTCCGGTCATTTCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000966.4-1274s21c1
Sequence:CCGGCAAAGCTGCCTGCCTAGATATCTCGAGATATCTAGGCAGGCAGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)