EMAIL THIS PAGE TO A FRIEND

RARRES1

retinoic acid receptor responder (tazarotene induced) 1

78 Gene Product Result for
Synonyms: LXNL TIG1
UniProtKB ID: P49788, Q8N1D7
Gene ID:
Human(5918) Summary: This gene was identified as a retinoid acid (RA) receptor-responsive gene. It encodes a type 1 membrane protein. The expression of this gene is upregulated by tazarotene as well as by retinoic acid receptors. The expression of this gene is found to be downregulated in prostate cancer, which is caused by the methylation of its promoter and CpG island. Alternatively spliced transcript variant encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(109222) retinoic acid receptor responder (tazarotene induced) 1
Rat(310486) retinoic acid receptor responder (tazarotene induced) 1
chicken(395209) retinoic acid receptor responder (tazarotene induced) 1
dog(612298) retinoic acid receptor responder (tazarotene induced) 1
naked mole-rat(101698009) retinoic acid receptor responder (tazarotene induced) 1
domestic guinea pig(100730295) retinoic acid receptor responder (tazarotene induced) 1
cow(510102) retinoic acid receptor responder (tazarotene induced) 1
sheep(101107654) retinoic acid receptor responder (tazarotene induced) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002888 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001164763 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001164763 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001164763 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002888 Rosetta Predictions human pricing
NM_206963 Rosetta Predictions human pricing
NM_001014790 Rosetta Predictions rat pricing
XM_001475793 Rosetta Predictions mouse pricing
XM_130987 Rosetta Predictions mouse pricing
XM_973599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035586 predicted 256
2 SASI_Hs01_00035587 predicted 476
3 SASI_Hs01_00035588 predicted 433
4 SASI_Hs01_00035589 predicted 476
5 SASI_Hs02_00334684 predicted 330
6 SASI_Hs01_00035590 predicted 357
7 SASI_Hs01_00035592 predicted 476
8 SASI_Hs01_00035593 predicted 256
9 SASI_Hs01_00035594 predicted 392
10 SASI_Hs01_00035595 predicted 389
11 SASI_Hs01_00035591 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242800 predicted 259
2 SASI_Hs01_00242801 predicted 485
3 SASI_Hs01_00242802 predicted 439
4 SASI_Hs01_00242803 predicted 483
5 SASI_Hs02_00373663 predicted 325
6 SASI_Hs01_00242804 predicted 356
7 SASI_Hs01_00242806 predicted 481
8 SASI_Hs01_00242807 predicted 258
9 SASI_Hs01_00242808 predicted 388
10 SASI_Hs01_00242809 predicted 391
11 SASI_Hs01_00242805 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014790 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050346 predicted 553
2 SASI_Rn01_00050347 predicted 529
3 SASI_Rn02_00201899 predicted 876
4 SASI_Rn01_00050349 predicted 710
5 SASI_Rn01_00050350 predicted 446
6 SASI_Rn01_00050352 predicted 747
7 SASI_Rn01_00050353 predicted 974
8 SASI_Rn01_00050354 predicted 427
9 SASI_Rn01_00050355 predicted 365
10 SASI_Rn02_00201900 predicted 854
11 SASI_Rn01_00050348 predicted 917
12 SASI_Rn01_00050351 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001475793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00384989 predicted 1044
2 SASI_Mm02_00384990 predicted 525
3 SASI_Mm02_00384991 predicted 698
4 SASI_Mm02_00384992 predicted 895
5 SASI_Mm02_00384993 predicted 981
6 SASI_Mm02_00384994 predicted 912
7 SASI_Mm02_00384995 predicted 621
8 SASI_Mm02_00384996 predicted 687
9 SASI_Mm02_00384997 predicted 478
10 SASI_Mm02_00384998 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130987 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251295 predicted 1032
2 SASI_Mm01_00251296 predicted 986
3 SASI_Mm01_00251297 predicted 1066
4 SASI_Mm01_00251298 predicted 1031
5 SASI_Mm01_00251299 predicted 1023
6 SASI_Mm01_00251300 predicted 1019
7 SASI_Mm01_00251301 predicted 1067
8 SASI_Mm01_00251302 predicted 1037
9 SASI_Mm01_00251303 predicted 1057
10 SASI_Mm01_00251304 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00445063 predicted 472
2 SASI_Mm02_00445064 predicted 693
3 SASI_Mm02_00445065 predicted 1031
4 SASI_Mm02_00445066 predicted 514
5 SASI_Mm02_00445067 predicted 523
6 SASI_Mm02_00445068 predicted 816
7 SASI_Mm02_00445069 predicted 451
8 SASI_Mm02_00445070 predicted 836
9 SASI_Mm02_00445071 predicted 1024
10 SASI_Mm02_00445072 predicted 1048
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002888
RARRES1 MISSION shRNA Bacterial Glycerol Stock
retinoic acid receptor responder (tazarotene induced) 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002888.2-582s1c1
Sequence:CCGGCCCTTGGAAATAGTCAGCATACTCGAGTATGCTGACTATTTCCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002888.2-405s1c1
Sequence:CCGGCCAGAGTCTTTACTTCAGGAACTCGAGTTCCTGAAGTAAAGACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002888.2-659s1c1
Sequence:CCGGCCTTGGAAGCTCTTACGTGATCTCGAGATCACGTAAGAGCTTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002888.2-481s1c1
Sequence:CCGGCCAGACCAACCATCAATGTAACTCGAGTTACATTGATGGTTGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002888.2-557s1c1
Sequence:CCGGCAAGCAAATGAAGCAACTGAACTCGAGTTCAGTTGCTTCATTTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002888.2-695s21c1
Sequence:CCGGACAGGTGTCACACTACTACTTCTCGAGAAGTAGTAGTGTGACACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002888.2-632s21c1
Sequence:CCGGTCTGAGACTCATCTGGGATTTCTCGAGAAATCCCAGATGAGTCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002888.2-504s21c1
Sequence:CCGGTGTACACGGCTCATCGAGAAACTCGAGTTTCTCGATGAGCCGTGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002888
RARRES1 MISSION shRNA shRNA Plasmid DNA
retinoic acid receptor responder (tazarotene induced) 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002888.2-582s1c1
Sequence:CCGGCCCTTGGAAATAGTCAGCATACTCGAGTATGCTGACTATTTCCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002888.2-405s1c1
Sequence:CCGGCCAGAGTCTTTACTTCAGGAACTCGAGTTCCTGAAGTAAAGACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002888.2-659s1c1
Sequence:CCGGCCTTGGAAGCTCTTACGTGATCTCGAGATCACGTAAGAGCTTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002888.2-481s1c1
Sequence:CCGGCCAGACCAACCATCAATGTAACTCGAGTTACATTGATGGTTGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002888.2-557s1c1
Sequence:CCGGCAAGCAAATGAAGCAACTGAACTCGAGTTCAGTTGCTTCATTTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002888.2-695s21c1
Sequence:CCGGACAGGTGTCACACTACTACTTCTCGAGAAGTAGTAGTGTGACACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002888.2-632s21c1
Sequence:CCGGTCTGAGACTCATCTGGGATTTCTCGAGAAATCCCAGATGAGTCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002888.2-504s21c1
Sequence:CCGGTGTACACGGCTCATCGAGAAACTCGAGTTTCTCGATGAGCCGTGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002888
RARRES1 MISSION shRNA Lentiviral Transduction Particles
retinoic acid receptor responder (tazarotene induced) 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002888.2-582s1c1
Sequence:CCGGCCCTTGGAAATAGTCAGCATACTCGAGTATGCTGACTATTTCCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002888.2-405s1c1
Sequence:CCGGCCAGAGTCTTTACTTCAGGAACTCGAGTTCCTGAAGTAAAGACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002888.2-659s1c1
Sequence:CCGGCCTTGGAAGCTCTTACGTGATCTCGAGATCACGTAAGAGCTTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002888.2-481s1c1
Sequence:CCGGCCAGACCAACCATCAATGTAACTCGAGTTACATTGATGGTTGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002888.2-557s1c1
Sequence:CCGGCAAGCAAATGAAGCAACTGAACTCGAGTTCAGTTGCTTCATTTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002888.2-695s21c1
Sequence:CCGGACAGGTGTCACACTACTACTTCTCGAGAAGTAGTAGTGTGACACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002888.2-632s21c1
Sequence:CCGGTCTGAGACTCATCTGGGATTTCTCGAGAAATCCCAGATGAGTCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002888.2-504s21c1
Sequence:CCGGTGTACACGGCTCATCGAGAAACTCGAGTTTCTCGATGAGCCGTGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164763
RARRES1 MISSION shRNA Bacterial Glycerol Stock
retinoic acid receptor responder (tazarotene induced) 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164763.1-1158s21c1
Sequence:CCGGCTGGACATATTGTGGTTATTTCTCGAGAAATAACCACAATATGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164763.1-1241s21c1
Sequence:CCGGGCTAATCTCAGGCAAATATTTCTCGAGAAATATTTGCCTGAGATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164763.1-936s21c1
Sequence:CCGGACCGCCAGAGTTCGGTAATTTCTCGAGAAATTACCGAACTCTGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164763.1-697s21c1
Sequence:CCGGACCCAGGTCCTGCACTATTACCTCGAGGTAATAGTGCAGGACCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164763.1-533s21c1
Sequence:CCGGAGAGACAAGAGAAGGATTATCCTCGAGGATAATCCTTCTCTTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164763.1-383s21c1
Sequence:CCGGGCGAAGTGGACTTGGTATTTACTCGAGTAAATACCAAGTCCACTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164763.1-811s21c1
Sequence:CCGGGAAATCATTCCCTGCCGTATTCTCGAGAATACGGCAGGGAATGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164763
RARRES1 MISSION shRNA shRNA Plasmid DNA
retinoic acid receptor responder (tazarotene induced) 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164763.1-1158s21c1
Sequence:CCGGCTGGACATATTGTGGTTATTTCTCGAGAAATAACCACAATATGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164763.1-1241s21c1
Sequence:CCGGGCTAATCTCAGGCAAATATTTCTCGAGAAATATTTGCCTGAGATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164763.1-936s21c1
Sequence:CCGGACCGCCAGAGTTCGGTAATTTCTCGAGAAATTACCGAACTCTGGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164763.1-697s21c1
Sequence:CCGGACCCAGGTCCTGCACTATTACCTCGAGGTAATAGTGCAGGACCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164763.1-533s21c1
Sequence:CCGGAGAGACAAGAGAAGGATTATCCTCGAGGATAATCCTTCTCTTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164763.1-383s21c1
Sequence:CCGGGCGAAGTGGACTTGGTATTTACTCGAGTAAATACCAAGTCCACTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164763.1-811s21c1
Sequence:CCGGGAAATCATTCCCTGCCGTATTCTCGAGAATACGGCAGGGAATGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164763
RARRES1 MISSION shRNA Lentiviral Transduction Particles
retinoic acid receptor responder (tazarotene induced) 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164763.1-1158s21c1
Sequence:CCGGCTGGACATATTGTGGTTATTTCTCGAGAAATAACCACAATATGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164763.1-1241s21c1
Sequence:CCGGGCTAATCTCAGGCAAATATTTCTCGAGAAATATTTGCCTGAGATTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164763.1-936s21c1
Sequence:CCGGACCGCCAGAGTTCGGTAATTTCTCGAGAAATTACCGAACTCTGGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164763.1-697s21c1
Sequence:CCGGACCCAGGTCCTGCACTATTACCTCGAGGTAATAGTGCAGGACCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164763.1-533s21c1
Sequence:CCGGAGAGACAAGAGAAGGATTATCCTCGAGGATAATCCTTCTCTTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164763.1-383s21c1
Sequence:CCGGGCGAAGTGGACTTGGTATTTACTCGAGTAAATACCAAGTCCACTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164763.1-811s21c1
Sequence:CCGGGAAATCATTCCCTGCCGTATTCTCGAGAATACGGCAGGGAATGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)