EMAIL THIS PAGE TO A FRIEND

RARRES2

retinoic acid receptor responder (tazarotene induced) 2

51 Gene Product Result for
Synonyms: HP10433 TIG2
UniProtKB ID: Q99969, Q7LE02
Gene ID:
Human(5919) Summary: This gene encodes a secreted chemotactic protein that initiates chemotaxis via the ChemR23 G protein-coupled seven-transmembrane domain ligand. Expression of this gene is upregulated by the synthetic retinoid tazarotene and occurs in a wide variety of tissues. The active protein has several roles, including that as an adipokine, and is truncated on both termini from the proprotein. [provided by RefSeq, Dec 2008]
Mouse(71660) retinoic acid receptor responder (tazarotene induced) 2
Rat(297073) retinoic acid receptor responder (tazarotene induced) 2
cow(508990) retinoic acid receptor responder (tazarotene induced) 2
sheep(101122516) retinoic acid receptor responder (tazarotene induced) 2
domestic guinea pig(100731741) retinoic acid receptor responder (tazarotene induced) 2
naked mole-rat(101724968) retinoic acid receptor responder (tazarotene induced) 2
chicken(420366) retinoic acid receptor responder (tazarotene induced) 2
domestic cat(101091433) retinoic acid receptor responder (tazarotene induced) 2
dog(475532) retinoic acid receptor responder (tazarotene induced) 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002889 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002889 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002889 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027852 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027852 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027852 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002889 Rosetta Predictions human pricing
NM_001013427 Rosetta Predictions rat pricing
NM_027852 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010247 predicted 367
2 SASI_Hs01_00010248 predicted 340
3 SASI_Hs01_00010250 predicted 231
4 SASI_Hs01_00010251 predicted 229
5 SASI_Hs02_00334685 predicted 229
6 SASI_Hs01_00010253 predicted 321
7 SASI_Hs02_00334686 predicted 331
8 SASI_Hs01_00010254 predicted 356
9 SASI_Hs02_00334687 predicted 226
10 SASI_Hs02_00334688 predicted 227
11 SASI_Hs01_00010249 predicted 259
12 SASI_Hs01_00010252 predicted 310
13 SASI_Hs01_00010255 predicted 294
14 SASI_Hs01_00010256 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013427 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065605 predicted 313
2 SASI_Rn01_00065606 predicted 277
3 SASI_Rn01_00065607 predicted 359
4 SASI_Rn01_00065608 predicted 266
5 SASI_Rn02_00201094 predicted 338
6 SASI_Rn01_00065609 predicted 317
7 SASI_Rn01_00065611 predicted 303
8 SASI_Rn01_00065612 predicted 278
9 SASI_Rn01_00065613 predicted 358
10 SASI_Rn02_00201095 predicted 261
11 SASI_Rn01_00065610 predicted 377
12 SASI_Rn01_00065614 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198933 predicted 297
2 SASI_Mm01_00198934 predicted 359
3 SASI_Mm01_00198935 predicted 282
4 SASI_Mm01_00198936 predicted 239
5 SASI_Mm01_00198937 predicted 293
6 SASI_Mm01_00198938 predicted 265
7 SASI_Mm01_00198939 predicted 231
8 SASI_Mm01_00198940 predicted 374
9 SASI_Mm01_00198941 predicted 219
10 SASI_Mm01_00198942 predicted 270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002889
RARRES2 MISSION shRNA Bacterial Glycerol Stock
retinoic acid receptor responder (tazarotene induced) 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002889.3-208s21c1
Sequence:CCGGCAGGTGGCCCTGGAGGAATTTCTCGAGAAATTCCTCCAGGGCCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002889.3-469s21c1
Sequence:CCGGCCCATAGAGACCCAAGTTCTGCTCGAGCAGAACTTGGGTCTCTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002889.3-291s21c1
Sequence:CCGGGCCCTTCCCAGCTGGAATATTCTCGAGAATATTCCAGCTGGGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002889.2-332s1c1
Sequence:CCGGCCAATGGGAGGAAACGGAAATCTCGAGATTTCCGTTTCCTCCCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002889.2-500s1c1
Sequence:CCGGGCTTCTACTTCCCTGGACAGTCTCGAGACTGTCCAGGGAAGTAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002889.2-370s1c1
Sequence:CCGGCTGGGCTCTGAGGACAAAGTTCTCGAGAACTTTGTCCTCAGAGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002889.2-304s1c1
Sequence:CCGGTGGAAGAAACCCGAGTGCAAACTCGAGTTTGCACTCGGGTTTCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002889.2-261s1c1
Sequence:CCGGGCTGGAATTTAAGCTGCAGCACTCGAGTGCTGCAGCTTAAATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002889
RARRES2 MISSION shRNA shRNA Plasmid DNA
retinoic acid receptor responder (tazarotene induced) 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002889.3-208s21c1
Sequence:CCGGCAGGTGGCCCTGGAGGAATTTCTCGAGAAATTCCTCCAGGGCCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002889.3-469s21c1
Sequence:CCGGCCCATAGAGACCCAAGTTCTGCTCGAGCAGAACTTGGGTCTCTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002889.3-291s21c1
Sequence:CCGGGCCCTTCCCAGCTGGAATATTCTCGAGAATATTCCAGCTGGGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002889.2-332s1c1
Sequence:CCGGCCAATGGGAGGAAACGGAAATCTCGAGATTTCCGTTTCCTCCCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002889.2-500s1c1
Sequence:CCGGGCTTCTACTTCCCTGGACAGTCTCGAGACTGTCCAGGGAAGTAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002889.2-370s1c1
Sequence:CCGGCTGGGCTCTGAGGACAAAGTTCTCGAGAACTTTGTCCTCAGAGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002889.2-304s1c1
Sequence:CCGGTGGAAGAAACCCGAGTGCAAACTCGAGTTTGCACTCGGGTTTCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002889.2-261s1c1
Sequence:CCGGGCTGGAATTTAAGCTGCAGCACTCGAGTGCTGCAGCTTAAATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002889
RARRES2 MISSION shRNA Lentiviral Transduction Particles
retinoic acid receptor responder (tazarotene induced) 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002889.3-208s21c1
Sequence:CCGGCAGGTGGCCCTGGAGGAATTTCTCGAGAAATTCCTCCAGGGCCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002889.3-469s21c1
Sequence:CCGGCCCATAGAGACCCAAGTTCTGCTCGAGCAGAACTTGGGTCTCTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002889.3-291s21c1
Sequence:CCGGGCCCTTCCCAGCTGGAATATTCTCGAGAATATTCCAGCTGGGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002889.2-332s1c1
Sequence:CCGGCCAATGGGAGGAAACGGAAATCTCGAGATTTCCGTTTCCTCCCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002889.2-500s1c1
Sequence:CCGGGCTTCTACTTCCCTGGACAGTCTCGAGACTGTCCAGGGAAGTAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002889.2-370s1c1
Sequence:CCGGCTGGGCTCTGAGGACAAAGTTCTCGAGAACTTTGTCCTCAGAGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002889.2-304s1c1
Sequence:CCGGTGGAAGAAACCCGAGTGCAAACTCGAGTTTGCACTCGGGTTTCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002889.2-261s1c1
Sequence:CCGGGCTGGAATTTAAGCTGCAGCACTCGAGTGCTGCAGCTTAAATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027852
RARRES2 MISSION shRNA Bacterial Glycerol Stock
retinoic acid receptor responder (tazarotene induced) 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027852.1-295s1c1
Sequence:CCGGGCACCTTTGTGAGGTTGGAATCTCGAGATTCCAACCTCACAAAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027852.1-164s1c1
Sequence:CCGGGCCCGAACTCAGCGAGACCCACTCGAGTGGGTCTCGCTGAGTTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027852.1-299s1c1
Sequence:CCGGCTTTGTGAGGTTGGAATTTAACTCGAGTTAAATTCCAACCTCACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027852.1-367s1c1
Sequence:CCGGGCACAATCAAACCAAACGGGACTCGAGTCCCGTTTGGTTTGATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027852.1-270s1c1
Sequence:CCGGGCTGAAGAAGTGCTCTTCTCACTCGAGTGAGAAGAGCACTTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027852
RARRES2 MISSION shRNA shRNA Plasmid DNA
retinoic acid receptor responder (tazarotene induced) 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027852.1-295s1c1
Sequence:CCGGGCACCTTTGTGAGGTTGGAATCTCGAGATTCCAACCTCACAAAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027852.1-164s1c1
Sequence:CCGGGCCCGAACTCAGCGAGACCCACTCGAGTGGGTCTCGCTGAGTTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027852.1-299s1c1
Sequence:CCGGCTTTGTGAGGTTGGAATTTAACTCGAGTTAAATTCCAACCTCACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027852.1-367s1c1
Sequence:CCGGGCACAATCAAACCAAACGGGACTCGAGTCCCGTTTGGTTTGATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027852.1-270s1c1
Sequence:CCGGGCTGAAGAAGTGCTCTTCTCACTCGAGTGAGAAGAGCACTTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027852
RARRES2 MISSION shRNA Lentiviral Transduction Particles
retinoic acid receptor responder (tazarotene induced) 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027852.1-295s1c1
Sequence:CCGGGCACCTTTGTGAGGTTGGAATCTCGAGATTCCAACCTCACAAAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027852.1-164s1c1
Sequence:CCGGGCCCGAACTCAGCGAGACCCACTCGAGTGGGTCTCGCTGAGTTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027852.1-299s1c1
Sequence:CCGGCTTTGTGAGGTTGGAATTTAACTCGAGTTAAATTCCAACCTCACAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027852.1-367s1c1
Sequence:CCGGGCACAATCAAACCAAACGGGACTCGAGTCCCGTTTGGTTTGATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027852.1-270s1c1
Sequence:CCGGGCTGAAGAAGTGCTCTTCTCACTCGAGTGAGAAGAGCACTTCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)