EMAIL THIS PAGE TO A FRIEND

RARRES3

retinoic acid receptor responder (tazarotene induced) 3

27 Gene Product Result for
Synonyms: HRASLS4 HRSL4 PLA1/2-3 RIG1 TIG3
UniProtKB ID: Q9UL19, B2R599, B4DDW2, E7ENZ7, O95200
Gene ID:
Human(5920) Summary: Retinoids exert biologic effects such as potent growth inhibitory and cell differentiation activities and are used in the treatment of hyperproliferative dermatological diseases. These effects are mediated by specific nuclear receptor proteins that are members of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. RARRES1, RARRES2, and RARRES3 are genes whose expression is upregulated by the synthetic retinoid tazarotene. RARRES3 is thought act as a tumor suppressor or growth regulator. [provided by RefSeq, Jul 2008]
dog(483772) retinoic acid receptor responder (tazarotene induced) 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004585 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004585 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004585 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062281 MISSION® esiRNA esiRNA human RARRES3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004585 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216653 predicted 296
2 SASI_Hs01_00216654 predicted 281
3 SASI_Hs01_00216655 predicted 315
4 SASI_Hs01_00216657 predicted 226
5 SASI_Hs02_00337934 predicted 272
6 SASI_Hs01_00216656 predicted 301
7 SASI_Hs02_00337935 predicted 277
8 SASI_Hs02_00337936 predicted 194
9 SASI_Hs01_00216659 predicted 275
10 SASI_Hs01_00216661 predicted 278
11 SASI_Hs01_00216658 predicted 270
12 SASI_Hs01_00216660 predicted 245
13 SASI_Hs01_00216662 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004585
VALIDATED
RARRES3 MISSION shRNA Bacterial Glycerol Stock
retinoic acid receptor responder (tazarotene induced) 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004585.2-435s1c1
Sequence:CCGGCCCGCTGTAAACAGGTGGAAACTCGAGTTTCCACCTGTTTACAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004585.2-136s1c1
Sequence:CCGGCCTGTATATAGGAGATGGCTACTCGAGTAGCCATCTCCTATATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_004585.2-485s1c1
Sequence:CCGGGCGCTTGGAATCCTGGTTGTTCTCGAGAACAACCAGGATTCCAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_004585.2-376s1c1
Sequence:CCGGGTACAGTATTGTGAGCAGGAACTCGAGTTCCTGCTCACAATACTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004585.2-274s1c1
Sequence:CCGGCTGTTGCTATCGGGTCAACAACTCGAGTTGTTGACCCGATAGCAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004585.3-132s21c1
Sequence:CCGGGAGCACTGGGCCCTGTATATACTCGAGTATATACAGGGCCCAGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004585.3-526s21c1
Sequence:CCGGTTGCGATTAGGAGATACCAAACTCGAGTTTGGTATCTCCTAATCGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004585.3-432s21c1
Sequence:CCGGTATGGCAAGTCCCGCTGTAAACTCGAGTTTACAGCGGGACTTGCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004585.3-232s21c1
Sequence:CCGGGCAACAGTGCAGAGGTGAAACCTCGAGGTTTCACCTCTGCACTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004585
VALIDATED
RARRES3 MISSION shRNA shRNA Plasmid DNA
retinoic acid receptor responder (tazarotene induced) 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004585.2-435s1c1
Sequence:CCGGCCCGCTGTAAACAGGTGGAAACTCGAGTTTCCACCTGTTTACAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004585.2-136s1c1
Sequence:CCGGCCTGTATATAGGAGATGGCTACTCGAGTAGCCATCTCCTATATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_004585.2-485s1c1
Sequence:CCGGGCGCTTGGAATCCTGGTTGTTCTCGAGAACAACCAGGATTCCAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_004585.2-376s1c1
Sequence:CCGGGTACAGTATTGTGAGCAGGAACTCGAGTTCCTGCTCACAATACTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004585.2-274s1c1
Sequence:CCGGCTGTTGCTATCGGGTCAACAACTCGAGTTGTTGACCCGATAGCAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004585.3-132s21c1
Sequence:CCGGGAGCACTGGGCCCTGTATATACTCGAGTATATACAGGGCCCAGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004585.3-526s21c1
Sequence:CCGGTTGCGATTAGGAGATACCAAACTCGAGTTTGGTATCTCCTAATCGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004585.3-432s21c1
Sequence:CCGGTATGGCAAGTCCCGCTGTAAACTCGAGTTTACAGCGGGACTTGCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004585.3-232s21c1
Sequence:CCGGGCAACAGTGCAGAGGTGAAACCTCGAGGTTTCACCTCTGCACTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004585
VALIDATED
RARRES3 MISSION shRNA Lentiviral Transduction Particles
retinoic acid receptor responder (tazarotene induced) 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004585.2-435s1c1
Sequence:CCGGCCCGCTGTAAACAGGTGGAAACTCGAGTTTCCACCTGTTTACAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004585.2-136s1c1
Sequence:CCGGCCTGTATATAGGAGATGGCTACTCGAGTAGCCATCTCCTATATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_004585.2-485s1c1
Sequence:CCGGGCGCTTGGAATCCTGGTTGTTCTCGAGAACAACCAGGATTCCAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_004585.2-376s1c1
Sequence:CCGGGTACAGTATTGTGAGCAGGAACTCGAGTTCCTGCTCACAATACTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004585.2-274s1c1
Sequence:CCGGCTGTTGCTATCGGGTCAACAACTCGAGTTGTTGACCCGATAGCAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004585.3-132s21c1
Sequence:CCGGGAGCACTGGGCCCTGTATATACTCGAGTATATACAGGGCCCAGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004585.3-526s21c1
Sequence:CCGGTTGCGATTAGGAGATACCAAACTCGAGTTTGGTATCTCCTAATCGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004585.3-432s21c1
Sequence:CCGGTATGGCAAGTCCCGCTGTAAACTCGAGTTTACAGCGGGACTTGCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004585.3-232s21c1
Sequence:CCGGGCAACAGTGCAGAGGTGAAACCTCGAGGTTTCACCTCTGCACTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)