EMAIL THIS PAGE TO A FRIEND

RARS

arginyl-tRNA synthetase

61 Gene Product Result for
Synonyms: ArgRS DALRD1
UniProtKB ID: P54136, B2RBS9, Q53GY4, Q9BWA1
Gene ID:
Human(5917) Summary: Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Arginyl-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Jul 2008]
Mouse(104458) arginyl-tRNA synthetase
Rat(287191) arginyl-tRNA synthetase
Zebrafish(337070) arginyl-tRNA synthetase
Horse(100059383) arginyl-tRNA synthetase
domestic cat(101085601) arginyl-tRNA synthetase
dog(609803) arginyl-tRNA synthetase
chicken(416168) arginyl-tRNA synthetase
naked mole-rat(101712302) arginyl-tRNA synthetase
Domestic Rabbit(100338051) arginyl-tRNA synthetase
domestic guinea pig(100713022) arginyl-tRNA synthetase
cow(506305) arginyl-tRNA synthetase
sheep(101117669) arginyl-tRNA synthetase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002887 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025936 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025936 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025936 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002887 Rosetta Predictions human pricing
NM_001105777 Rosetta Predictions rat pricing
NM_025936 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117178 predicted 793
2 SASI_Hs01_00117179 predicted 918
3 SASI_Hs02_00334680 predicted 705
4 SASI_Hs01_00117181 predicted 375
5 SASI_Hs01_00117182 predicted 1047
6 SASI_Hs01_00117184 predicted 725
7 SASI_Hs01_00117185 predicted 741
8 SASI_Hs02_00334681 predicted 375
9 SASI_Hs02_00334682 predicted 1179
10 SASI_Hs02_00334683 predicted 1403
11 SASI_Hs01_00117180 predicted 1238
12 SASI_Hs01_00117183 predicted 509
13 SASI_Hs01_00117186 predicted 1216
14 SASI_Hs01_00117187 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212426 predicted 1255
2 SASI_Rn02_00212427 predicted 512
3 SASI_Rn02_00212428 predicted 770
4 SASI_Rn02_00212429 predicted 1026
5 SASI_Rn02_00212430 predicted 1772
6 SASI_Rn02_00212431 predicted 342
7 SASI_Rn02_00212432 predicted 593
8 SASI_Rn02_00212433 predicted 364
9 SASI_Rn02_00212434 predicted 1390
10 SASI_Rn02_00212435 predicted 1503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025936 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161356 predicted 1340
2 SASI_Mm01_00161357 predicted 442
3 SASI_Mm01_00161358 predicted 1392
4 SASI_Mm01_00161359 predicted 1298
5 SASI_Mm01_00161361 predicted 721
6 SASI_Mm01_00161362 predicted 347
7 SASI_Mm01_00161363 predicted 1508
8 SASI_Mm01_00161364 predicted 1037
9 SASI_Mm01_00161365 predicted 996
10 SASI_Mm02_00329323 predicted 1648
11 SASI_Mm01_00161360 predicted 1027
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002887
VALIDATED
RARS MISSION shRNA Bacterial Glycerol Stock
arginyl-tRNA synthetase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002887.3-473s1c1
Sequence:CCGGCCTCCCAGACAATGAATGTATCTCGAGATACATTCATTGTCTGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002887.3-1651s1c1
Sequence:CCGGCCTTCACTAGAATCAGGTCTACTCGAGTAGACCTGATTCTAGTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002887.3-1823s1c1
Sequence:CCGGCCACACTCTCTGTGATTATATCTCGAGATATAATCACAGAGAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002887.3-1150s1c1
Sequence:CCGGCCATACCATTAACCATAGTAACTCGAGTTACTATGGTTAATGGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002887.3-906s1c1
Sequence:CCGGCGAGCATATCAGTGTGTAGTTCTCGAGAACTACACACTGATATGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002887.3-1150s21c1
Sequence:CCGGCCATACCATTAACCATAGTAACTCGAGTTACTATGGTTAATGGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002887.3-1823s21c1
Sequence:CCGGCCACACTCTCTGTGATTATATCTCGAGATATAATCACAGAGAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002887.3-1651s21c1
Sequence:CCGGCCTTCACTAGAATCAGGTCTACTCGAGTAGACCTGATTCTAGTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002887.3-906s21c1
Sequence:CCGGCGAGCATATCAGTGTGTAGTTCTCGAGAACTACACACTGATATGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002887.3-473s21c1
Sequence:CCGGCCTCCCAGACAATGAATGTATCTCGAGATACATTCATTGTCTGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002887
VALIDATED
RARS MISSION shRNA shRNA Plasmid DNA
arginyl-tRNA synthetase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002887.3-473s1c1
Sequence:CCGGCCTCCCAGACAATGAATGTATCTCGAGATACATTCATTGTCTGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002887.3-1651s1c1
Sequence:CCGGCCTTCACTAGAATCAGGTCTACTCGAGTAGACCTGATTCTAGTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002887.3-1823s1c1
Sequence:CCGGCCACACTCTCTGTGATTATATCTCGAGATATAATCACAGAGAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002887.3-1150s1c1
Sequence:CCGGCCATACCATTAACCATAGTAACTCGAGTTACTATGGTTAATGGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002887.3-906s1c1
Sequence:CCGGCGAGCATATCAGTGTGTAGTTCTCGAGAACTACACACTGATATGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002887.3-1150s21c1
Sequence:CCGGCCATACCATTAACCATAGTAACTCGAGTTACTATGGTTAATGGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002887.3-1823s21c1
Sequence:CCGGCCACACTCTCTGTGATTATATCTCGAGATATAATCACAGAGAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002887.3-1651s21c1
Sequence:CCGGCCTTCACTAGAATCAGGTCTACTCGAGTAGACCTGATTCTAGTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002887.3-906s21c1
Sequence:CCGGCGAGCATATCAGTGTGTAGTTCTCGAGAACTACACACTGATATGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002887.3-473s21c1
Sequence:CCGGCCTCCCAGACAATGAATGTATCTCGAGATACATTCATTGTCTGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002887
VALIDATED
RARS MISSION shRNA Lentiviral Transduction Particles
arginyl-tRNA synthetase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002887.3-473s1c1
Sequence:CCGGCCTCCCAGACAATGAATGTATCTCGAGATACATTCATTGTCTGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002887.3-1651s1c1
Sequence:CCGGCCTTCACTAGAATCAGGTCTACTCGAGTAGACCTGATTCTAGTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002887.3-1823s1c1
Sequence:CCGGCCACACTCTCTGTGATTATATCTCGAGATATAATCACAGAGAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002887.3-1150s1c1
Sequence:CCGGCCATACCATTAACCATAGTAACTCGAGTTACTATGGTTAATGGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002887.3-906s1c1
Sequence:CCGGCGAGCATATCAGTGTGTAGTTCTCGAGAACTACACACTGATATGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002887.3-1150s21c1
Sequence:CCGGCCATACCATTAACCATAGTAACTCGAGTTACTATGGTTAATGGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002887.3-1823s21c1
Sequence:CCGGCCACACTCTCTGTGATTATATCTCGAGATATAATCACAGAGAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002887.3-1651s21c1
Sequence:CCGGCCTTCACTAGAATCAGGTCTACTCGAGTAGACCTGATTCTAGTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002887.3-906s21c1
Sequence:CCGGCGAGCATATCAGTGTGTAGTTCTCGAGAACTACACACTGATATGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002887.3-473s21c1
Sequence:CCGGCCTCCCAGACAATGAATGTATCTCGAGATACATTCATTGTCTGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025936
VALIDATED
RARS MISSION shRNA Bacterial Glycerol Stock
arginyl-tRNA synthetase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000075949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025936.1-694s1c1
Sequence:CCGGCCTCTTTGAATTTGCAGGATACTCGAGTATCCTGCAAATTCAAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025936.1-1547s1c1
Sequence:CCGGCTTTCTCATAATCGCCTCAATCTCGAGATTGAGGCGATTATGAGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025936.1-1292s1c1
Sequence:CCGGGCTCAGATGATTGGCTGGTATCTCGAGATACCAGCCAATCATCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025936.1-1700s1c2
Sequence:CCGGGCTCGGGAAACCAAGATCATTCTCGAGAATGATCTTGGTTTCCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025936
VALIDATED
RARS MISSION shRNA shRNA Plasmid DNA
arginyl-tRNA synthetase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000075949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025936.1-694s1c1
Sequence:CCGGCCTCTTTGAATTTGCAGGATACTCGAGTATCCTGCAAATTCAAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025936.1-1547s1c1
Sequence:CCGGCTTTCTCATAATCGCCTCAATCTCGAGATTGAGGCGATTATGAGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025936.1-1292s1c1
Sequence:CCGGGCTCAGATGATTGGCTGGTATCTCGAGATACCAGCCAATCATCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025936.1-1700s1c2
Sequence:CCGGGCTCGGGAAACCAAGATCATTCTCGAGAATGATCTTGGTTTCCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025936
VALIDATED
RARS MISSION shRNA Lentiviral Transduction Particles
arginyl-tRNA synthetase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000075949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025936.1-694s1c1
Sequence:CCGGCCTCTTTGAATTTGCAGGATACTCGAGTATCCTGCAAATTCAAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025936.1-1547s1c1
Sequence:CCGGCTTTCTCATAATCGCCTCAATCTCGAGATTGAGGCGATTATGAGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025936.1-1292s1c1
Sequence:CCGGGCTCAGATGATTGGCTGGTATCTCGAGATACCAGCCAATCATCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025936.1-1700s1c2
Sequence:CCGGGCTCGGGAAACCAAGATCATTCTCGAGAATGATCTTGGTTTCCCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)