EMAIL THIS PAGE TO A FRIEND

RASA1

RAS p21 protein activator (GTPase activating protein) 1

81 Gene Product Result for
Synonyms: CM-AVM CMAVM GAP PKWS RASA RASGAP p120GAP p120RASGAP
UniProtKB ID: P20936, B2R6W3, Q9UDI1
Gene ID:
Human(5921) Summary: The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]
Mouse(218397) RAS p21 protein activator 1
Rat(25676) RAS p21 protein activator (GTPase activating protein) 1
chicken(427327) RAS p21 protein activator (GTPase activating protein) 1
dog(479158) RAS p21 protein activator (GTPase activating protein) 1
domestic cat(101095151) RAS p21 protein activator (GTPase activating protein) 1
cow(282032) RAS p21 protein activator (GTPase activating protein) 1
sheep(101119216) RAS p21 protein activator (GTPase activating protein) 1
naked mole-rat(101713771) RAS p21 protein activator (GTPase activating protein) 1
domestic guinea pig(100726441) RAS p21 protein activator (GTPase activating protein) 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145452 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145452 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145452 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022650 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002890 Rosetta Predictions human pricing
NM_022650 Rosetta Predictions human pricing
NM_013135 Rosetta Predictions rat pricing
NM_145452 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220764 predicted 2503
2 SASI_Hs01_00220765 predicted 1377
3 SASI_Hs01_00220766 predicted 1051
4 SASI_Hs01_00220768 predicted 2650
5 SASI_Hs02_00334689 predicted 1970
6 SASI_Hs02_00334690 predicted 1266
7 SASI_Hs02_00334691 predicted 2925
8 SASI_Hs02_00334692 predicted 1455
9 SASI_Hs01_00220770 predicted 3244
10 SASI_Hs01_00220771 predicted 2412
11 SASI_Hs01_00220762 predicted 1139
12 SASI_Hs01_00220763 predicted 874
13 SASI_Hs01_00220767 predicted 1200
14 SASI_Hs01_00220769 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150837 predicted 1950
2 SASI_Hs01_00150838 predicted 829
3 SASI_Hs01_00150839 predicted 502
4 SASI_Hs01_00150841 predicted 2105
5 SASI_Hs02_00355911 predicted 1422
6 SASI_Hs02_00355912 predicted 710
7 SASI_Hs02_00355913 predicted 2380
8 SASI_Hs02_00355914 predicted 897
9 SASI_Hs01_00150842 predicted 2692
10 SASI_Hs01_00150843 predicted 1854
11 SASI_Hs01_00150835 predicted 595
12 SASI_Hs01_00150836 predicted 325
13 SASI_Hs01_00150840 predicted 648
14 SASI_Hs01_00150844 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056364 predicted 1117
2 SASI_Rn02_00260933 predicted 2024
3 SASI_Rn01_00056365 predicted 2439
4 SASI_Rn01_00056366 predicted 728
5 SASI_Rn01_00056367 predicted 1975
6 SASI_Rn01_00056369 predicted 1543
7 SASI_Rn01_00056370 predicted 2820
8 SASI_Rn01_00056371 predicted 1231
9 SASI_Rn01_00056372 predicted 1798
10 SASI_Rn02_00260934 predicted 2485
11 SASI_Rn01_00056368 predicted 1932
12 SASI_Rn01_00056373 predicted 2497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163255 predicted 3159
2 SASI_Mm01_00163257 predicted 2604
3 SASI_Mm01_00163258 predicted 1813
4 SASI_Mm01_00163259 predicted 2095
5 SASI_Mm01_00163260 predicted 2839
6 SASI_Mm01_00163261 predicted 1758
7 SASI_Mm02_00340839 predicted 1305
8 SASI_Mm01_00163263 predicted 3548
9 SASI_Mm01_00163264 predicted 2547
10 SASI_Mm02_00340840 predicted 3493
11 SASI_Mm01_00163256 predicted 1775
12 SASI_Mm01_00163262 predicted 1781
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145452
VALIDATED
RASA1 MISSION shRNA Bacterial Glycerol Stock
RAS p21 protein activator (GTPase activating protein) 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145452.3-3945s21c1
Sequence:CCGGGAGCCTTGGTGTACCCTTAACCTCGAGGTTAAGGGTACACCAAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145452.3-1149s21c1
Sequence:CCGGGAAATCTGGAAGCTATCTTATCTCGAGATAAGATAGCTTCCAGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145452.3-1299s21c1
Sequence:CCGGCTCAGACCTAATAGGTTATTACTCGAGTAATAACCTATTAGGTCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145452.3-1780s21c1
Sequence:CCGGATGATGGGAGGCCGCTATTATCTCGAGATAATAGCGGCCTCCCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145452.3-3719s21c1
Sequence:CCGGCAGTATGCCCACCGTGGTAATCTCGAGATTACCACGGTGGGCATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145452.3-1840s21c1
Sequence:CCGGCAGATTGTTGAAGGCTATTATCTCGAGATAATAGCCTTCAACAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145452.3-2896s21c1
Sequence:CCGGGATGAAGCCACTACCCTATTTCTCGAGAAATAGGGTAGTGGCTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145452.1-2476s1c1
Sequence:CCGGCCGTGGTAATTCACACCATCACTCGAGTGATGGTGTGAATTACCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145452.1-2240s1c1
Sequence:CCGGCGGACACTACAGAGCATTCTACTCGAGTAGAATGCTCTGTAGTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145452.1-2148s1c1
Sequence:CCGGGCCTTATATGGAAGGTGTCAACTCGAGTTGACACCTTCCATATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145452.1-1240s1c1
Sequence:CCGGCCTCCTGACATCAATAGATTTCTCGAGAAATCTATTGATGTCAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145452.1-1769s1c1
Sequence:CCGGGCAAGCAATCATGTGAGTTAACTCGAGTTAACTCACATGATTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145452
VALIDATED
RASA1 MISSION shRNA shRNA Plasmid DNA
RAS p21 protein activator (GTPase activating protein) 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145452.3-3945s21c1
Sequence:CCGGGAGCCTTGGTGTACCCTTAACCTCGAGGTTAAGGGTACACCAAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145452.3-1149s21c1
Sequence:CCGGGAAATCTGGAAGCTATCTTATCTCGAGATAAGATAGCTTCCAGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145452.3-1299s21c1
Sequence:CCGGCTCAGACCTAATAGGTTATTACTCGAGTAATAACCTATTAGGTCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145452.3-1780s21c1
Sequence:CCGGATGATGGGAGGCCGCTATTATCTCGAGATAATAGCGGCCTCCCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145452.3-3719s21c1
Sequence:CCGGCAGTATGCCCACCGTGGTAATCTCGAGATTACCACGGTGGGCATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145452.3-1840s21c1
Sequence:CCGGCAGATTGTTGAAGGCTATTATCTCGAGATAATAGCCTTCAACAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145452.3-2896s21c1
Sequence:CCGGGATGAAGCCACTACCCTATTTCTCGAGAAATAGGGTAGTGGCTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145452.1-2476s1c1
Sequence:CCGGCCGTGGTAATTCACACCATCACTCGAGTGATGGTGTGAATTACCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145452.1-2240s1c1
Sequence:CCGGCGGACACTACAGAGCATTCTACTCGAGTAGAATGCTCTGTAGTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145452.1-2148s1c1
Sequence:CCGGGCCTTATATGGAAGGTGTCAACTCGAGTTGACACCTTCCATATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145452.1-1240s1c1
Sequence:CCGGCCTCCTGACATCAATAGATTTCTCGAGAAATCTATTGATGTCAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145452.1-1769s1c1
Sequence:CCGGGCAAGCAATCATGTGAGTTAACTCGAGTTAACTCACATGATTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145452
VALIDATED
RASA1 MISSION shRNA Lentiviral Transduction Particles
RAS p21 protein activator (GTPase activating protein) 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145452.3-3945s21c1
Sequence:CCGGGAGCCTTGGTGTACCCTTAACCTCGAGGTTAAGGGTACACCAAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145452.3-1149s21c1
Sequence:CCGGGAAATCTGGAAGCTATCTTATCTCGAGATAAGATAGCTTCCAGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145452.3-1299s21c1
Sequence:CCGGCTCAGACCTAATAGGTTATTACTCGAGTAATAACCTATTAGGTCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145452.3-1780s21c1
Sequence:CCGGATGATGGGAGGCCGCTATTATCTCGAGATAATAGCGGCCTCCCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145452.3-3719s21c1
Sequence:CCGGCAGTATGCCCACCGTGGTAATCTCGAGATTACCACGGTGGGCATACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145452.3-1840s21c1
Sequence:CCGGCAGATTGTTGAAGGCTATTATCTCGAGATAATAGCCTTCAACAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145452.3-2896s21c1
Sequence:CCGGGATGAAGCCACTACCCTATTTCTCGAGAAATAGGGTAGTGGCTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145452.1-2476s1c1
Sequence:CCGGCCGTGGTAATTCACACCATCACTCGAGTGATGGTGTGAATTACCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145452.1-2240s1c1
Sequence:CCGGCGGACACTACAGAGCATTCTACTCGAGTAGAATGCTCTGTAGTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145452.1-2148s1c1
Sequence:CCGGGCCTTATATGGAAGGTGTCAACTCGAGTTGACACCTTCCATATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145452.1-1240s1c1
Sequence:CCGGCCTCCTGACATCAATAGATTTCTCGAGAAATCTATTGATGTCAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145452.1-1769s1c1
Sequence:CCGGGCAAGCAATCATGTGAGTTAACTCGAGTTAACTCACATGATTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022650
VALIDATED
RASA1 MISSION shRNA Bacterial Glycerol Stock
RAS p21 protein activator (GTPase activating protein) 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022650.1-1644s21c1
Sequence:CCGGCAGCTCCCATATACCATTAAACTCGAGTTTAATGGTATATGGGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022650.1-2344s21c1
Sequence:CCGGGCTGCAAGAACACTGATATTACTCGAGTAATATCAGTGTTCTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022650.1-3180s21c1
Sequence:CCGGCATTTGACTGTTCAATGATTACTCGAGTAATCATTGAACAGTCAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022650.1-2533s21c1
Sequence:CCGGACGGACCTGTCCCGTGATTTACTCGAGTAAATCACGGGACAGGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022650.1-1063s21c1
Sequence:CCGGGGTAGTGATGCCCAACTTATTCTCGAGAATAAGTTGGGCATCACTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022650.1-776s21c1
Sequence:CCGGCAACGCCAAACAATCAGTTTACTCGAGTAAACTGATTGTTTGGCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022650.1-708s21c1
Sequence:CCGGTAATACTCCTGGCGATTATTCCTCGAGGAATAATCGCCAGGAGTATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022650.1-2903s21c1
Sequence:CCGGGCAGGATATTTGCACTATTTCCTCGAGGAAATAGTGCAAATATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A-431
TRC Version: 1 Clone ID:NM_022650.1-3594s1c1
Sequence:CCGGGCTGCCTAACTTATCCATCTTCTCGAGAAGATGGATAAGTTAGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022650.1-1880s1c1
Sequence:CCGGGCACACTAAATGACAGAGAAACTCGAGTTTCTCTGTCATTTAGTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022650.1-1513s1c1
Sequence:CCGGCCTGACATCAATAGATTTGAACTCGAGTTCAAATCTATTGATGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_022650.1-2419s1c1
Sequence:CCGGCCCTACATGGAAGGTGTCAATCTCGAGATTGACACCTTCCATGTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_022650.1-715s1c1
Sequence:CCGGCCTGGCGATTATTCACTTTATCTCGAGATAAAGTGAATAATCGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022650
VALIDATED
RASA1 MISSION shRNA shRNA Plasmid DNA
RAS p21 protein activator (GTPase activating protein) 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022650.1-1644s21c1
Sequence:CCGGCAGCTCCCATATACCATTAAACTCGAGTTTAATGGTATATGGGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022650.1-2344s21c1
Sequence:CCGGGCTGCAAGAACACTGATATTACTCGAGTAATATCAGTGTTCTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022650.1-3180s21c1
Sequence:CCGGCATTTGACTGTTCAATGATTACTCGAGTAATCATTGAACAGTCAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022650.1-2533s21c1
Sequence:CCGGACGGACCTGTCCCGTGATTTACTCGAGTAAATCACGGGACAGGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022650.1-1063s21c1
Sequence:CCGGGGTAGTGATGCCCAACTTATTCTCGAGAATAAGTTGGGCATCACTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022650.1-776s21c1
Sequence:CCGGCAACGCCAAACAATCAGTTTACTCGAGTAAACTGATTGTTTGGCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022650.1-708s21c1
Sequence:CCGGTAATACTCCTGGCGATTATTCCTCGAGGAATAATCGCCAGGAGTATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022650.1-2903s21c1
Sequence:CCGGGCAGGATATTTGCACTATTTCCTCGAGGAAATAGTGCAAATATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A-431
TRC Version: 1 Clone ID:NM_022650.1-3594s1c1
Sequence:CCGGGCTGCCTAACTTATCCATCTTCTCGAGAAGATGGATAAGTTAGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022650.1-1880s1c1
Sequence:CCGGGCACACTAAATGACAGAGAAACTCGAGTTTCTCTGTCATTTAGTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022650.1-1513s1c1
Sequence:CCGGCCTGACATCAATAGATTTGAACTCGAGTTCAAATCTATTGATGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_022650.1-2419s1c1
Sequence:CCGGCCCTACATGGAAGGTGTCAATCTCGAGATTGACACCTTCCATGTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_022650.1-715s1c1
Sequence:CCGGCCTGGCGATTATTCACTTTATCTCGAGATAAAGTGAATAATCGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022650
VALIDATED
RASA1 MISSION shRNA Lentiviral Transduction Particles
RAS p21 protein activator (GTPase activating protein) 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022650.1-1644s21c1
Sequence:CCGGCAGCTCCCATATACCATTAAACTCGAGTTTAATGGTATATGGGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022650.1-2344s21c1
Sequence:CCGGGCTGCAAGAACACTGATATTACTCGAGTAATATCAGTGTTCTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231929    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022650.1-3180s21c1
Sequence:CCGGCATTTGACTGTTCAATGATTACTCGAGTAATCATTGAACAGTCAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022650.1-2533s21c1
Sequence:CCGGACGGACCTGTCCCGTGATTTACTCGAGTAAATCACGGGACAGGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022650.1-1063s21c1
Sequence:CCGGGGTAGTGATGCCCAACTTATTCTCGAGAATAAGTTGGGCATCACTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022650.1-776s21c1
Sequence:CCGGCAACGCCAAACAATCAGTTTACTCGAGTAAACTGATTGTTTGGCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022650.1-708s21c1
Sequence:CCGGTAATACTCCTGGCGATTATTCCTCGAGGAATAATCGCCAGGAGTATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_022650.1-2903s21c1
Sequence:CCGGGCAGGATATTTGCACTATTTCCTCGAGGAAATAGTGCAAATATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A-431
TRC Version: 1 Clone ID:NM_022650.1-3594s1c1
Sequence:CCGGGCTGCCTAACTTATCCATCTTCTCGAGAAGATGGATAAGTTAGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022650.1-1880s1c1
Sequence:CCGGGCACACTAAATGACAGAGAAACTCGAGTTTCTCTGTCATTTAGTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022650.1-1513s1c1
Sequence:CCGGCCTGACATCAATAGATTTGAACTCGAGTTCAAATCTATTGATGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_022650.1-2419s1c1
Sequence:CCGGCCCTACATGGAAGGTGTCAATCTCGAGATTGACACCTTCCATGTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_022650.1-715s1c1
Sequence:CCGGCCTGGCGATTATTCACTTTATCTCGAGATAAAGTGAATAATCGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)