EMAIL THIS PAGE TO A FRIEND

RASA4

RAS p21 protein activator 4

90 Gene Product Result for
Synonyms: CAPRI GAPL
UniProtKB ID: O43374, O60286, Q14CQ4, Q86UW3, Q96QU0
Gene ID:
Human(10156) Summary: This gene encodes a member of the GAP1 family of GTPase-activating proteins that suppresses the Ras/mitogen-activated protein kinase pathway in response to Ca(2+). Stimuli that increase intracellular Ca(2+) levels result in the translocation of this protein to the plasma membrane, where it activates Ras GTPase activity. Consequently, Ras is converted from the active GTP-bound state to the inactive GDP-bound state and no longer activates downstream pathways that regulate gene expression, cell growth, and differentiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(54153) RAS p21 protein activator 4
Rat(288589) RAS p21 protein activator 4
Zebrafish(567599) RAS p21 protein activator 4
Horse(100060748) RAS p21 protein activator 4
domestic cat(101091420) RAS p21 protein activator 4
dog(489819) RAS p21 protein activator 4
chicken(417513) RAS p21 protein activator 4
domestic guinea pig(100732664) RAS p21 protein activator 4
naked mole-rat(101720607) RAS p21 protein activator 4
cow(521224) RAS p21 protein activator 4
sheep(101117299) RAS p21 protein activator 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006989 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006989 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006989 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039103 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039103 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039103 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079877 Rosetta Predictions human pricing
NM_006989 Rosetta Predictions human pricing
XM_213751 Rosetta Predictions rat pricing
XR_009137 Rosetta Predictions rat pricing
NM_001039103 Rosetta Predictions mouse pricing
NM_133914 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314040 predicted 691
2 SASI_Hs02_00314041 predicted 331
3 SASI_Hs02_00314042 predicted 1056
4 SASI_Hs02_00314043 predicted 304
5 SASI_Hs02_00314044 predicted 2768
6 SASI_Hs02_00314045 predicted 344
7 SASI_Hs02_00314046 predicted 335
8 SASI_Hs02_00314047 predicted 697
9 SASI_Hs02_00314048 predicted 1110
10 SASI_Hs02_00314049 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099826 predicted 690
2 SASI_Hs01_00099824 predicted 326
3 SASI_Hs02_00342729 predicted 1055
4 SASI_Hs01_00099827 predicted 310
5 SASI_Hs02_00342730 predicted 350
6 SASI_Hs01_00099828 predicted 336
7 SASI_Hs02_00342731 predicted 704
8 SASI_Hs01_00099829 predicted 1104
9 SASI_Hs02_00342732 predicted 601
10 SASI_Hs01_00099822 predicted 1223
11 SASI_Hs01_00099823 predicted 2194
12 SASI_Hs01_00099825 predicted 1812
13 SASI_Hs01_00099830 predicted 2187
14 SASI_Hs01_00099831 predicted 1726
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00188319 predicted 1423
2 SASI_Rn01_00188320 predicted 262
3 SASI_Rn01_00188321 predicted 1297
4 SASI_Rn01_00188322 predicted 731
5 SASI_Rn01_00188323 predicted 2043
6 SASI_Rn01_00188324 predicted 2239
7 SASI_Rn01_00188325 predicted 2217
8 SASI_Rn01_00188326 predicted 2261
9 SASI_Rn01_00188327 predicted 1972
10 SASI_Rn01_00188328 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00175757 predicted 1273
2 SASI_Rn01_00175759 predicted 918
3 SASI_Rn01_00175761 predicted 2422
4 SASI_Rn01_00175762 predicted 2615
5 SASI_Rn01_00175763 predicted 2593
6 SASI_Rn01_00175764 predicted 2641
7 SASI_Rn01_00175765 predicted 2346
8 SASI_Rn01_00175766 predicted 1452
9 SASI_Rn02_00418869 predicted 1266
10 SASI_Rn02_00418870 predicted 2409
11 SASI_Rn01_00175758 predicted 1811
12 SASI_Rn01_00175760 predicted 1687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105982 predicted 813
2 SASI_Mm01_00105984 predicted 816
3 SASI_Mm01_00105985 predicted 1822
4 SASI_Mm01_00105986 predicted 836
5 SASI_Mm01_00105987 predicted 1829
6 SASI_Mm01_00105988 predicted 2493
7 SASI_Mm01_00105989 predicted 1801
8 SASI_Mm01_00105990 predicted 1062
9 SASI_Mm01_00105991 predicted 1811
10 SASI_Mm02_00289783 predicted 2299
11 SASI_Mm01_00105983 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080249 predicted 819
2 SASI_Mm01_00080251 predicted 812
3 SASI_Mm02_00338982 predicted 1961
4 SASI_Mm01_00080252 predicted 840
5 SASI_Mm01_00080253 predicted 1964
6 SASI_Mm01_00080254 predicted 2640
7 SASI_Mm01_00080256 predicted 1937
8 SASI_Mm01_00080257 predicted 1062
9 SASI_Mm01_00080258 predicted 1949
10 SASI_Mm02_00338983 predicted 2447
11 SASI_Mm01_00080250 predicted 1223
12 SASI_Mm01_00080255 predicted 849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006989
VALIDATED
RASA4 MISSION shRNA Bacterial Glycerol Stock
RAS p21 protein activator 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006989.4-703s21c1
Sequence:CCGGCTGGGCAAAGTGGTGATTGATCTCGAGATCAATCACCACTTTGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006989.4-1099s21c1
Sequence:CCGGAGCAACTCTCTGGCCTCAAAGCTCGAGCTTTGAGGCCAGAGAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006989.4-263s21c1
Sequence:CCGGTCCACGCTGTGGCTTTCTATGCTCGAGCATAGAAAGCCACAGCGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006989.4-332s21c1
Sequence:CCGGGCCTTACAAGGGACACCATAGCTCGAGCTATGGTGTCCCTTGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006989.3-128s1c1
Sequence:CCGGTGCATCGTGAAGGTGGACAATCTCGAGATTGTCCACCTTCACGATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006989.3-4525s1c1
Sequence:CCGGGCCCAGCTAATTCTTGTATTTCTCGAGAAATACAAGAATTAGCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006989.3-1879s1c1
Sequence:CCGGCCTCATCAAGTTAGCCAACATCTCGAGATGTTGGCTAACTTGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006989.3-1148s1c1
Sequence:CCGGCCCATCATCAACAAGGTGTTTCTCGAGAAACACCTTGTTGATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006989.3-575s1c1
Sequence:CCGGCGCTGGAATGAGACGTTTGAACTCGAGTTCAAACGTCTCATTCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006989
VALIDATED
RASA4 MISSION shRNA shRNA Plasmid DNA
RAS p21 protein activator 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006989.4-703s21c1
Sequence:CCGGCTGGGCAAAGTGGTGATTGATCTCGAGATCAATCACCACTTTGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006989.4-1099s21c1
Sequence:CCGGAGCAACTCTCTGGCCTCAAAGCTCGAGCTTTGAGGCCAGAGAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006989.4-263s21c1
Sequence:CCGGTCCACGCTGTGGCTTTCTATGCTCGAGCATAGAAAGCCACAGCGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006989.4-332s21c1
Sequence:CCGGGCCTTACAAGGGACACCATAGCTCGAGCTATGGTGTCCCTTGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006989.3-128s1c1
Sequence:CCGGTGCATCGTGAAGGTGGACAATCTCGAGATTGTCCACCTTCACGATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006989.3-4525s1c1
Sequence:CCGGGCCCAGCTAATTCTTGTATTTCTCGAGAAATACAAGAATTAGCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006989.3-1879s1c1
Sequence:CCGGCCTCATCAAGTTAGCCAACATCTCGAGATGTTGGCTAACTTGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006989.3-1148s1c1
Sequence:CCGGCCCATCATCAACAAGGTGTTTCTCGAGAAACACCTTGTTGATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006989.3-575s1c1
Sequence:CCGGCGCTGGAATGAGACGTTTGAACTCGAGTTCAAACGTCTCATTCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006989
VALIDATED
RASA4 MISSION shRNA Lentiviral Transduction Particles
RAS p21 protein activator 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006989.4-703s21c1
Sequence:CCGGCTGGGCAAAGTGGTGATTGATCTCGAGATCAATCACCACTTTGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006989.4-1099s21c1
Sequence:CCGGAGCAACTCTCTGGCCTCAAAGCTCGAGCTTTGAGGCCAGAGAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006989.4-263s21c1
Sequence:CCGGTCCACGCTGTGGCTTTCTATGCTCGAGCATAGAAAGCCACAGCGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006989.4-332s21c1
Sequence:CCGGGCCTTACAAGGGACACCATAGCTCGAGCTATGGTGTCCCTTGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006989.3-128s1c1
Sequence:CCGGTGCATCGTGAAGGTGGACAATCTCGAGATTGTCCACCTTCACGATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006989.3-4525s1c1
Sequence:CCGGGCCCAGCTAATTCTTGTATTTCTCGAGAAATACAAGAATTAGCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006989.3-1879s1c1
Sequence:CCGGCCTCATCAAGTTAGCCAACATCTCGAGATGTTGGCTAACTTGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006989.3-1148s1c1
Sequence:CCGGCCCATCATCAACAAGGTGTTTCTCGAGAAACACCTTGTTGATGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006989.3-575s1c1
Sequence:CCGGCGCTGGAATGAGACGTTTGAACTCGAGTTCAAACGTCTCATTCCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039103
RASA4 MISSION shRNA Bacterial Glycerol Stock
RAS p21 protein activator 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039103.2-832s21c1
Sequence:CCGGTAGGCAAAGTGGCGGTCAATGCTCGAGCATTGACCGCCACTTTGCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039103.2-667s21c1
Sequence:CCGGTTGTCCGAGTGCACTACAATGCTCGAGCATTGTAGTGCACTCGGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039103.2-1574s21c1
Sequence:CCGGGGTCCAGAACATAGGCAATATCTCGAGATATTGCCTATGTTCTGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039103.2-2564s21c1
Sequence:CCGGTGTGACCCAGCATAGTCTTCTCTCGAGAGAAGACTATGCTGGGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039103.2-286s21c1
Sequence:CCGGGCATCGTGAAGGTGGACAATGCTCGAGCATTGTCCACCTTCACGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039103
RASA4 MISSION shRNA shRNA Plasmid DNA
RAS p21 protein activator 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039103.2-832s21c1
Sequence:CCGGTAGGCAAAGTGGCGGTCAATGCTCGAGCATTGACCGCCACTTTGCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039103.2-667s21c1
Sequence:CCGGTTGTCCGAGTGCACTACAATGCTCGAGCATTGTAGTGCACTCGGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039103.2-1574s21c1
Sequence:CCGGGGTCCAGAACATAGGCAATATCTCGAGATATTGCCTATGTTCTGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039103.2-2564s21c1
Sequence:CCGGTGTGACCCAGCATAGTCTTCTCTCGAGAGAAGACTATGCTGGGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039103.2-286s21c1
Sequence:CCGGGCATCGTGAAGGTGGACAATGCTCGAGCATTGTCCACCTTCACGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039103
RASA4 MISSION shRNA Lentiviral Transduction Particles
RAS p21 protein activator 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039103.2-832s21c1
Sequence:CCGGTAGGCAAAGTGGCGGTCAATGCTCGAGCATTGACCGCCACTTTGCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039103.2-667s21c1
Sequence:CCGGTTGTCCGAGTGCACTACAATGCTCGAGCATTGTAGTGCACTCGGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039103.2-1574s21c1
Sequence:CCGGGGTCCAGAACATAGGCAATATCTCGAGATATTGCCTATGTTCTGGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039103.2-2564s21c1
Sequence:CCGGTGTGACCCAGCATAGTCTTCTCTCGAGAGAAGACTATGCTGGGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039103.2-286s21c1
Sequence:CCGGGCATCGTGAAGGTGGACAATGCTCGAGCATTGTCCACCTTCACGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)