EMAIL THIS PAGE TO A FRIEND

RASAL1

RAS protein activator like 1 (GAP1 like)

51 Gene Product Result for
Synonyms: RASAL
Gene ID:
Human(8437) Summary: The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. These proteins stimulate the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. This particular family member contains domains which are characteristic of the GAP1 subfamily of RasGAP proteins but, in contrast to the other GAP1 family members, this protein is strongly and selectively expressed in endocrine tissues. Alternatively spliced transcript variants that encode different isoforms have been described [provided by RefSeq, Jul 2010]
Mouse(19415) RAS protein activator like 1 (GAP1 like)
Rat(360814) RAS protein activator like 1 (GAP1 like)
chicken(771057) RAS protein activator like 1 (GAP1 like)
domestic cat(101088621) RAS protein activator like 1 (GAP1 like)
dog(486277) RAS protein activator like 1 (GAP1 like)
cow(512872) RAS protein activator like 1 (GAP1 like)
sheep(101109393) RAS protein activator like 1 (GAP1 like)
naked mole-rat(101697586) RAS protein activator like 1 (GAP1 like)
Domestic Rabbit(100341044) RAS protein activator like 1 (GAP1 like)
domestic guinea pig(100717596) RAS protein activator like 1 (GAP1 like)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004658 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013832 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013832 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013832 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004658 Rosetta Predictions human pricing
NM_001108335 Rosetta Predictions rat pricing
NM_013832 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186094 predicted 587
2 SASI_Hs01_00186095 predicted 1687
3 SASI_Hs01_00186096 predicted 1983
4 SASI_Hs01_00186098 predicted 942
5 SASI_Hs01_00186099 predicted 748
6 SASI_Hs01_00186100 predicted 1733
7 SASI_Hs02_00338072 predicted 1979
8 SASI_Hs01_00186101 predicted 1389
9 SASI_Hs01_00186102 predicted 1312
10 SASI_Hs02_00338073 predicted 2467
11 SASI_Hs01_00186093 predicted 2253
12 SASI_Hs01_00186097 predicted 2536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237649 predicted 2724
2 SASI_Rn02_00237650 predicted 2200
3 SASI_Rn02_00237651 predicted 1944
4 SASI_Rn02_00237652 predicted 444
5 SASI_Rn02_00237653 predicted 1259
6 SASI_Rn02_00237654 predicted 1156
7 SASI_Rn02_00237655 predicted 497
8 SASI_Rn02_00237656 predicted 2207
9 SASI_Rn02_00237657 predicted 1611
10 SASI_Rn02_00237658 predicted 1930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059438 predicted 1196
2 SASI_Mm01_00059439 predicted 1388
3 SASI_Mm01_00059440 predicted 1674
4 SASI_Mm01_00059441 predicted 441
5 SASI_Mm01_00059443 predicted 1261
6 SASI_Mm01_00059444 predicted 2203
7 SASI_Mm01_00059445 predicted 2209
8 SASI_Mm01_00059446 predicted 480
9 SASI_Mm01_00059447 predicted 1517
10 SASI_Mm02_00322817 predicted 1935
11 SASI_Mm01_00059442 predicted 2752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004658
RASAL1 MISSION shRNA Bacterial Glycerol Stock
RAS protein activator like 1 (GAP1 like)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004658.1-2936s21c1
Sequence:CCGGAGACTGGAGTGGATAGGATAACTCGAGTTATCCTATCCACTCCAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004658.1-1337s21c1
Sequence:CCGGCAAGTCGATGGAACAGTTTATCTCGAGATAAACTGTTCCATCGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004658.1-533s21c1
Sequence:CCGGCGACGACATCATCGGCAAGATCTCGAGATCTTGCCGATGATGTCGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004658.1-1045s21c1
Sequence:CCGGGAGTGAAGGTACGCCTGATTGCTCGAGCAATCAGGCGTACCTTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004658.1-1986s1c1
Sequence:CCGGGCCATTGTTCGAGAAGGCTATCTCGAGATAGCCTTCTCGAACAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004658.1-1398s1c1
Sequence:CCGGCCTGTGATTAGCCGTGTCTTTCTCGAGAAAGACACGGCTAATCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004658.1-588s1c1
Sequence:CCGGCGAGGGATTGACAGCTGGATTCTCGAGAATCCAGCTGTCAATCCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004658.1-2246s1c1
Sequence:CCGGCCTCCAGTGCAAGAATGTGAACTCGAGTTCACATTCTTGCACTGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004658.1-2898s1c1
Sequence:CCGGGCCTTGCACTGAGTGAAACTTCTCGAGAAGTTTCACTCAGTGCAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004658
RASAL1 MISSION shRNA shRNA Plasmid DNA
RAS protein activator like 1 (GAP1 like)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004658.1-2936s21c1
Sequence:CCGGAGACTGGAGTGGATAGGATAACTCGAGTTATCCTATCCACTCCAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004658.1-1337s21c1
Sequence:CCGGCAAGTCGATGGAACAGTTTATCTCGAGATAAACTGTTCCATCGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004658.1-533s21c1
Sequence:CCGGCGACGACATCATCGGCAAGATCTCGAGATCTTGCCGATGATGTCGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004658.1-1045s21c1
Sequence:CCGGGAGTGAAGGTACGCCTGATTGCTCGAGCAATCAGGCGTACCTTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004658.1-1986s1c1
Sequence:CCGGGCCATTGTTCGAGAAGGCTATCTCGAGATAGCCTTCTCGAACAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004658.1-1398s1c1
Sequence:CCGGCCTGTGATTAGCCGTGTCTTTCTCGAGAAAGACACGGCTAATCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004658.1-588s1c1
Sequence:CCGGCGAGGGATTGACAGCTGGATTCTCGAGAATCCAGCTGTCAATCCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004658.1-2246s1c1
Sequence:CCGGCCTCCAGTGCAAGAATGTGAACTCGAGTTCACATTCTTGCACTGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004658.1-2898s1c1
Sequence:CCGGGCCTTGCACTGAGTGAAACTTCTCGAGAAGTTTCACTCAGTGCAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004658
RASAL1 MISSION shRNA Lentiviral Transduction Particles
RAS protein activator like 1 (GAP1 like)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004658.1-2936s21c1
Sequence:CCGGAGACTGGAGTGGATAGGATAACTCGAGTTATCCTATCCACTCCAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004658.1-1337s21c1
Sequence:CCGGCAAGTCGATGGAACAGTTTATCTCGAGATAAACTGTTCCATCGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004658.1-533s21c1
Sequence:CCGGCGACGACATCATCGGCAAGATCTCGAGATCTTGCCGATGATGTCGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004658.1-1045s21c1
Sequence:CCGGGAGTGAAGGTACGCCTGATTGCTCGAGCAATCAGGCGTACCTTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004658.1-1986s1c1
Sequence:CCGGGCCATTGTTCGAGAAGGCTATCTCGAGATAGCCTTCTCGAACAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004658.1-1398s1c1
Sequence:CCGGCCTGTGATTAGCCGTGTCTTTCTCGAGAAAGACACGGCTAATCACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004658.1-588s1c1
Sequence:CCGGCGAGGGATTGACAGCTGGATTCTCGAGAATCCAGCTGTCAATCCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004658.1-2246s1c1
Sequence:CCGGCCTCCAGTGCAAGAATGTGAACTCGAGTTCACATTCTTGCACTGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004658.1-2898s1c1
Sequence:CCGGGCCTTGCACTGAGTGAAACTTCTCGAGAAGTTTCACTCAGTGCAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013832
RASAL1 MISSION shRNA Bacterial Glycerol Stock
RAS protein activator like 1 (GAP1 like)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013832.2-2865s1c1
Sequence:CCGGCCCAGTCTTGTACTGACCAAACTCGAGTTTGGTCAGTACAAGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013832.2-1954s1c1
Sequence:CCGGCCCTCAACCATTGTTCGAGAACTCGAGTTCTCGAACAATGGTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013832.2-971s1c1
Sequence:CCGGCCTTTCCTAGAGCTGAGGATTCTCGAGAATCCTCAGCTCTAGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013832.2-2220s1c1
Sequence:CCGGCCTCCAGTGTAAGAACGTGAACTCGAGTTCACGTTCTTACACTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013832.2-755s1c1
Sequence:CCGGGCAACCATAGTTTGGAAACTTCTCGAGAAGTTTCCAAACTATGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013832
RASAL1 MISSION shRNA shRNA Plasmid DNA
RAS protein activator like 1 (GAP1 like)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013832.2-2865s1c1
Sequence:CCGGCCCAGTCTTGTACTGACCAAACTCGAGTTTGGTCAGTACAAGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013832.2-1954s1c1
Sequence:CCGGCCCTCAACCATTGTTCGAGAACTCGAGTTCTCGAACAATGGTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013832.2-971s1c1
Sequence:CCGGCCTTTCCTAGAGCTGAGGATTCTCGAGAATCCTCAGCTCTAGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013832.2-2220s1c1
Sequence:CCGGCCTCCAGTGTAAGAACGTGAACTCGAGTTCACGTTCTTACACTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013832.2-755s1c1
Sequence:CCGGGCAACCATAGTTTGGAAACTTCTCGAGAAGTTTCCAAACTATGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013832
RASAL1 MISSION shRNA Lentiviral Transduction Particles
RAS protein activator like 1 (GAP1 like)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013832.2-2865s1c1
Sequence:CCGGCCCAGTCTTGTACTGACCAAACTCGAGTTTGGTCAGTACAAGACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013832.2-1954s1c1
Sequence:CCGGCCCTCAACCATTGTTCGAGAACTCGAGTTCTCGAACAATGGTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013832.2-971s1c1
Sequence:CCGGCCTTTCCTAGAGCTGAGGATTCTCGAGAATCCTCAGCTCTAGGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013832.2-2220s1c1
Sequence:CCGGCCTCCAGTGTAAGAACGTGAACTCGAGTTCACGTTCTTACACTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013832.2-755s1c1
Sequence:CCGGGCAACCATAGTTTGGAAACTTCTCGAGAAGTTTCCAAACTATGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)