EMAIL THIS PAGE TO A FRIEND

RASAL2

RAS protein activator like 2

127 Gene Product Result for
Synonyms: NGAP
UniProtKB ID: Q9UJF2, F8W755, O95174, Q2TB22, Q5TFU9
Gene ID:
Human(9462) Summary: This gene encodes a protein that contains the GAP-related domain (GRD), a characteristic domain of GTPase-activating proteins (GAPs). GAPs function as activators of Ras superfamily of small GTPases. The protein encoded by this gene is able to complement the defective RasGAP function in a yeast system. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(226525) RAS protein activator like 2
Rat(304893) RAS protein activator like 2
domestic guinea pig(100728903) RAS protein activator like 2
Domestic Rabbit(100358105) RAS protein activator like 2
naked mole-rat(101710345) RAS protein activator like 2
cow(540692) RAS protein activator like 2
sheep(101119234) RAS protein activator like 2
Zebrafish(793730) RAS protein activator like 2
chicken(429069) RAS protein activator like 2
Horse(100033986) RAS protein activator like 2
domestic cat(101100534) RAS protein activator like 2
dog(480056) RAS protein activator like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004841 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004841 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004841 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090641 MISSION® esiRNA esiRNA human RASAL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004841 Rosetta Predictions human pricing
NM_170692 Rosetta Predictions human pricing
NM_001107188 Rosetta Predictions rat pricing
NM_177644 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338422 predicted 603
2 SASI_Hs01_00122060 predicted 1172
3 SASI_Hs01_00122061 predicted 1372
4 SASI_Hs01_00122062 predicted 591
5 SASI_Hs01_00122063 predicted 2358
6 SASI_Hs01_00122064 predicted 3068
7 SASI_Hs01_00122065 predicted 3571
8 SASI_Hs01_00122066 predicted 3318
9 SASI_Hs01_00122067 predicted 2149
10 SASI_Hs01_00122068 predicted 2515
11 SASI_Hs01_00122069 predicted 1127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367623 predicted 922
2 SASI_Hs01_00083180 predicted 1482
3 SASI_Hs01_00083181 predicted 1683
4 SASI_Hs01_00083182 predicted 905
5 SASI_Hs01_00083183 predicted 2671
6 SASI_Hs01_00083184 predicted 3388
7 SASI_Hs01_00083185 predicted 3888
8 SASI_Hs01_00083186 predicted 3635
9 SASI_Hs01_00083187 predicted 2466
10 SASI_Hs01_00083188 predicted 2837
11 SASI_Hs01_00083189 predicted 1447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226375 predicted 2028
2 SASI_Rn02_00226376 predicted 1159
3 SASI_Rn02_00226377 predicted 1263
4 SASI_Rn02_00226378 predicted 1222
5 SASI_Rn02_00226379 predicted 1822
6 SASI_Rn02_00226380 predicted 1065
7 SASI_Rn02_00226381 predicted 1109
8 SASI_Rn02_00226382 predicted 3066
9 SASI_Rn02_00226383 predicted 2611
10 SASI_Rn02_00226384 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347894 predicted 2856
2 SASI_Mm02_00347895 predicted 1560
3 SASI_Mm02_00347896 predicted 1489
4 SASI_Mm02_00347897 predicted 2065
5 SASI_Mm02_00347898 predicted 1958
6 SASI_Mm02_00347899 predicted 1845
7 SASI_Mm02_00347900 predicted 1676
8 SASI_Mm02_00347901 predicted 2283
9 SASI_Mm02_00347902 predicted 1439
10 SASI_Mm02_00347903 predicted 2881
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177644
VALIDATED
RASAL2 MISSION shRNA Bacterial Glycerol Stock
RAS protein activator like 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177644.2-1445s1c1
Sequence:CCGGGCTGTCAGATATACAGAGATACTCGAGTATCTCTGTATATCTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177644.2-760s1c1
Sequence:CCGGCGTGTCTCTATCTACTGTCTTCTCGAGAAGACAGTAGATAGAGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177644.2-730s1c1
Sequence:CCGGGCTCTTTAGAGCTGACAGATTCTCGAGAATCTGTCAGCTCTAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177644.2-886s1c1
Sequence:CCGGCCATCTGACTAAATACCCTTTCTCGAGAAAGGGTATTTAGTCAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177644.2-862s1c1
Sequence:CCGGCCATTCAAGTAGACCACTCATCTCGAGATGAGTGGTCTACTTGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177644.4-189s21c1
Sequence:CCGGGGTCCGGGTGTTCGATGTAAACTCGAGTTTACATCGAACACCCGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177644.4-2440s21c1
Sequence:CCGGGATAACACAGACAGCTATTTCCTCGAGGAAATAGCTGTCTGTGTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177644.4-818s21c1
Sequence:CCGGGCTTCGAGGTCACCTACTTAACTCGAGTTAAGTAGGTGACCTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177644.4-1281s21c1
Sequence:CCGGAGGACCTTCTATTCGGATTAACTCGAGTTAATCCGAATAGAAGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177644.4-2288s21c1
Sequence:CCGGTGACTAATCCTACGCCAATACCTCGAGGTATTGGCGTAGGATTAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177644.5-5280s21c1
Sequence:CCGGGCTCTTTAGAGCTGACAGATTCTCGAGAATCTGTCAGCTCTAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177644.5-1770s21c1
Sequence:CCGGTCATAGCATCACGGTTCATATCTCGAGATATGAACCGTGATGCTATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177644
VALIDATED
RASAL2 MISSION shRNA shRNA Plasmid DNA
RAS protein activator like 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177644.2-1445s1c1
Sequence:CCGGGCTGTCAGATATACAGAGATACTCGAGTATCTCTGTATATCTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177644.2-760s1c1
Sequence:CCGGCGTGTCTCTATCTACTGTCTTCTCGAGAAGACAGTAGATAGAGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177644.2-730s1c1
Sequence:CCGGGCTCTTTAGAGCTGACAGATTCTCGAGAATCTGTCAGCTCTAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177644.2-886s1c1
Sequence:CCGGCCATCTGACTAAATACCCTTTCTCGAGAAAGGGTATTTAGTCAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177644.2-862s1c1
Sequence:CCGGCCATTCAAGTAGACCACTCATCTCGAGATGAGTGGTCTACTTGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177644.4-189s21c1
Sequence:CCGGGGTCCGGGTGTTCGATGTAAACTCGAGTTTACATCGAACACCCGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177644.4-2440s21c1
Sequence:CCGGGATAACACAGACAGCTATTTCCTCGAGGAAATAGCTGTCTGTGTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177644.4-818s21c1
Sequence:CCGGGCTTCGAGGTCACCTACTTAACTCGAGTTAAGTAGGTGACCTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177644.4-1281s21c1
Sequence:CCGGAGGACCTTCTATTCGGATTAACTCGAGTTAATCCGAATAGAAGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177644.4-2288s21c1
Sequence:CCGGTGACTAATCCTACGCCAATACCTCGAGGTATTGGCGTAGGATTAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177644.5-5280s21c1
Sequence:CCGGGCTCTTTAGAGCTGACAGATTCTCGAGAATCTGTCAGCTCTAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177644.5-1770s21c1
Sequence:CCGGTCATAGCATCACGGTTCATATCTCGAGATATGAACCGTGATGCTATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177644
VALIDATED
RASAL2 MISSION shRNA Lentiviral Transduction Particles
RAS protein activator like 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177644.2-1445s1c1
Sequence:CCGGGCTGTCAGATATACAGAGATACTCGAGTATCTCTGTATATCTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177644.2-760s1c1
Sequence:CCGGCGTGTCTCTATCTACTGTCTTCTCGAGAAGACAGTAGATAGAGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177644.2-730s1c1
Sequence:CCGGGCTCTTTAGAGCTGACAGATTCTCGAGAATCTGTCAGCTCTAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177644.2-886s1c1
Sequence:CCGGCCATCTGACTAAATACCCTTTCTCGAGAAAGGGTATTTAGTCAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177644.2-862s1c1
Sequence:CCGGCCATTCAAGTAGACCACTCATCTCGAGATGAGTGGTCTACTTGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177644.4-189s21c1
Sequence:CCGGGGTCCGGGTGTTCGATGTAAACTCGAGTTTACATCGAACACCCGGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177644.4-2440s21c1
Sequence:CCGGGATAACACAGACAGCTATTTCCTCGAGGAAATAGCTGTCTGTGTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177644.4-818s21c1
Sequence:CCGGGCTTCGAGGTCACCTACTTAACTCGAGTTAAGTAGGTGACCTCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177644.4-1281s21c1
Sequence:CCGGAGGACCTTCTATTCGGATTAACTCGAGTTAATCCGAATAGAAGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177644.4-2288s21c1
Sequence:CCGGTGACTAATCCTACGCCAATACCTCGAGGTATTGGCGTAGGATTAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177644.5-5280s21c1
Sequence:CCGGGCTCTTTAGAGCTGACAGATTCTCGAGAATCTGTCAGCTCTAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177644.5-1770s21c1
Sequence:CCGGTCATAGCATCACGGTTCATATCTCGAGATATGAACCGTGATGCTATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004841
RASAL2 MISSION shRNA Bacterial Glycerol Stock
RAS protein activator like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004841.x-1940s1c1
Sequence:CCGGCCCTCGTGTTCTTGCTGATATCTCGAGATATCAGCAAGAACACGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004841.x-1980s1c1
Sequence:CCGGCCTACGCCAATACAACAGCAACTCGAGTTGCTGTTGTATTGGCGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004841.x-784s1c1
Sequence:CCGGGCCTTCCACCTCTTCATAGTACTCGAGTACTATGAAGAGGTGGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004841.3-502s21c1
Sequence:CCGGGCTTTGAGGTTACCTACTTAACTCGAGTTAAGTAGGTAACCTCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004841.3-634s21c1
Sequence:CCGGTTCTTCGTTTATGGATCATTGCTCGAGCAATGATCCATAAACGAAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004841.3-891s21c1
Sequence:CCGGAGTGTGACTGGTCGCCAATTTCTCGAGAAATTGGCGACCAGTCACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004841.3-1634s21c1
Sequence:CCGGATCTCGGACTCTAACTCTTATCTCGAGATAAGAGTTAGAGTCCGAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004841
RASAL2 MISSION shRNA shRNA Plasmid DNA
RAS protein activator like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004841.x-1940s1c1
Sequence:CCGGCCCTCGTGTTCTTGCTGATATCTCGAGATATCAGCAAGAACACGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004841.x-1980s1c1
Sequence:CCGGCCTACGCCAATACAACAGCAACTCGAGTTGCTGTTGTATTGGCGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004841.x-784s1c1
Sequence:CCGGGCCTTCCACCTCTTCATAGTACTCGAGTACTATGAAGAGGTGGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004841.3-502s21c1
Sequence:CCGGGCTTTGAGGTTACCTACTTAACTCGAGTTAAGTAGGTAACCTCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004841.3-634s21c1
Sequence:CCGGTTCTTCGTTTATGGATCATTGCTCGAGCAATGATCCATAAACGAAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004841.3-891s21c1
Sequence:CCGGAGTGTGACTGGTCGCCAATTTCTCGAGAAATTGGCGACCAGTCACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004841.3-1634s21c1
Sequence:CCGGATCTCGGACTCTAACTCTTATCTCGAGATAAGAGTTAGAGTCCGAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004841
RASAL2 MISSION shRNA Lentiviral Transduction Particles
RAS protein activator like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004841.x-1940s1c1
Sequence:CCGGCCCTCGTGTTCTTGCTGATATCTCGAGATATCAGCAAGAACACGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004841.x-1980s1c1
Sequence:CCGGCCTACGCCAATACAACAGCAACTCGAGTTGCTGTTGTATTGGCGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004841.x-784s1c1
Sequence:CCGGGCCTTCCACCTCTTCATAGTACTCGAGTACTATGAAGAGGTGGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004841.3-502s21c1
Sequence:CCGGGCTTTGAGGTTACCTACTTAACTCGAGTTAAGTAGGTAACCTCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004841.3-634s21c1
Sequence:CCGGTTCTTCGTTTATGGATCATTGCTCGAGCAATGATCCATAAACGAAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004841.3-891s21c1
Sequence:CCGGAGTGTGACTGGTCGCCAATTTCTCGAGAAATTGGCGACCAGTCACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004841.3-1634s21c1
Sequence:CCGGATCTCGGACTCTAACTCTTATCTCGAGATAAGAGTTAGAGTCCGAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)