EMAIL THIS PAGE TO A FRIEND

RASAL3

RAS protein activator like 3

103 Gene Product Result for
UniProtKB ID: Q86YV0, Q8N2T9, Q9H735
Gene ID:
Mouse(320484) RAS protein activator like 3
Rat(314596) RAS protein activator like 3
Zebrafish(798492) RAS protein activator like 3
domestic cat(101090495) RAS protein activator like 3
dog(610409) RAS protein activator like 3
chicken(101747651) RAS protein activator like 3
chicken(101665571) RAS protein activator like 3
cow(540027) RAS protein activator like 3
sheep(101122784) RAS protein activator like 3
naked mole-rat(101725297) RAS protein activator like 3
domestic guinea pig(100732614) RAS protein activator like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_029084 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_029084 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_029084 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022904 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118521 MISSION® esiRNA esiRNA human AC011492.8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022904 Rosetta Predictions human pricing
XM_029084 Rosetta Predictions human pricing
NM_001134562 Rosetta Predictions rat pricing
NM_178785 Rosetta Predictions mouse pricing
XM_905818 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356200 predicted 2921
2 SASI_Hs02_00356201 predicted 2906
3 SASI_Hs02_00356202 predicted 2174
4 SASI_Hs02_00356203 predicted 1842
5 SASI_Hs02_00356204 predicted 885
6 SASI_Hs02_00356205 predicted 2173
7 SASI_Hs02_00356206 predicted 2421
8 SASI_Hs02_00356207 predicted 620
9 SASI_Hs02_00356208 predicted 2268
10 SASI_Hs02_00356209 predicted 2102
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_029084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268496 predicted 3032
2 SASI_Hs01_00268497 predicted 3021
3 SASI_Hs01_00268498 predicted 3056
4 SASI_Hs01_00268499 predicted 3038
5 SASI_Hs01_00268500 predicted 2706
6 SASI_Hs01_00268501 predicted 2856
7 SASI_Hs01_00268502 predicted 3061
8 SASI_Hs01_00268503 predicted 3044
9 SASI_Hs01_00268504 predicted 2810
10 SASI_Hs01_00268505 predicted 3040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134562 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257109 predicted 429
2 SASI_Rn02_00257110 predicted 1345
3 SASI_Rn02_00257111 predicted 2188
4 SASI_Rn02_00257112 predicted 1761
5 SASI_Rn02_00257113 predicted 3062
6 SASI_Rn02_00257114 predicted 1958
7 SASI_Rn02_00257115 predicted 829
8 SASI_Rn02_00257116 predicted 2026
9 SASI_Rn02_00257117 predicted 619
10 SASI_Rn02_00257118 predicted 2075
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349371 predicted 1722
2 SASI_Mm02_00349372 predicted 2344
3 SASI_Mm02_00349373 predicted 1732
4 SASI_Mm02_00349374 predicted 3266
5 SASI_Mm02_00349375 predicted 2545
6 SASI_Mm02_00349376 predicted 3028
7 SASI_Mm02_00349377 predicted 3218
8 SASI_Mm02_00349378 predicted 1914
9 SASI_Mm02_00349379 predicted 774
10 SASI_Mm02_00349380 predicted 2876
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905818 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236390 predicted 1959
2 SASI_Mm01_00236391 predicted 2577
3 SASI_Mm01_00236392 predicted 3504
4 SASI_Mm01_00236393 predicted 2782
5 SASI_Mm01_00236394 predicted 3270
6 SASI_Mm01_00236395 predicted 3440
7 SASI_Mm01_00236396 predicted 3461
8 SASI_Mm01_00236397 predicted 2149
9 SASI_Mm01_00236398 predicted 1014
10 SASI_Mm01_00236399 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_029084
RASAL3 MISSION shRNA Bacterial Glycerol Stock
RAS protein activator like 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029084.5-2932s1c1
Sequence:CCGGCACAACCTAACAAGCAATGAACTCGAGTTCATTGCTTGTTAGGTTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029084.5-936s1c1
Sequence:CCGGCGAGGACCTTCGTCGCCAATTCTCGAGAATTGGCGACGAAGGTCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_029084.5-3128s1c1
Sequence:CCGGCTGCCTCATCACACGTGGTCTCTCGAGAGACCACGTGTGATGAGGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029084.5-1390s1c1
Sequence:CCGGGAGTTCCTCACCTTCCACTATCTCGAGATAGTGGAAGGTGAGGAACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029084.5-1768s1c1
Sequence:CCGGGAGGAGGTCTTCGAAACCATTCTCGAGAATGGTTTCGAAGACCTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_029084
RASAL3 MISSION shRNA shRNA Plasmid DNA
RAS protein activator like 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029084.5-2932s1c1
Sequence:CCGGCACAACCTAACAAGCAATGAACTCGAGTTCATTGCTTGTTAGGTTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029084.5-936s1c1
Sequence:CCGGCGAGGACCTTCGTCGCCAATTCTCGAGAATTGGCGACGAAGGTCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_029084.5-3128s1c1
Sequence:CCGGCTGCCTCATCACACGTGGTCTCTCGAGAGACCACGTGTGATGAGGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029084.5-1390s1c1
Sequence:CCGGGAGTTCCTCACCTTCCACTATCTCGAGATAGTGGAAGGTGAGGAACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029084.5-1768s1c1
Sequence:CCGGGAGGAGGTCTTCGAAACCATTCTCGAGAATGGTTTCGAAGACCTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_029084
RASAL3 MISSION shRNA Lentiviral Transduction Particles
RAS protein activator like 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029084.5-2932s1c1
Sequence:CCGGCACAACCTAACAAGCAATGAACTCGAGTTCATTGCTTGTTAGGTTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029084.5-936s1c1
Sequence:CCGGCGAGGACCTTCGTCGCCAATTCTCGAGAATTGGCGACGAAGGTCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_029084.5-3128s1c1
Sequence:CCGGCTGCCTCATCACACGTGGTCTCTCGAGAGACCACGTGTGATGAGGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029084.5-1390s1c1
Sequence:CCGGGAGTTCCTCACCTTCCACTATCTCGAGATAGTGGAAGGTGAGGAACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029084.5-1768s1c1
Sequence:CCGGGAGGAGGTCTTCGAAACCATTCTCGAGAATGGTTTCGAAGACCTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178785
RASAL3 MISSION shRNA Bacterial Glycerol Stock
RAS protein activator like 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178785.2-1590s1c1
Sequence:CCGGGCCATTGATGAATACATGAAACTCGAGTTTCATGTATTCATCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178785.2-1551s1c1
Sequence:CCGGGAAGCACTGCTATTCCGAGAACTCGAGTTCTCGGAATAGCAGTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178785.2-351s1c1
Sequence:CCGGCCACTGGAACCCAAGCCAAATCTCGAGATTTGGCTTGGGTTCCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178785.2-462s1c1
Sequence:CCGGGTTTGGAACATTGATGGCTTTCTCGAGAAAGCCATCAATGTTCCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178785.2-474s1c1
Sequence:CCGGGATGGCTTTACCCTTCTCGAACTCGAGTTCGAGAAGGGTAAAGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178785.3-2892s21c1
Sequence:CCGGACAATGTGAGGTGGCTATATTCTCGAGAATATAGCCACCTCACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178785.3-2181s21c1
Sequence:CCGGGGAAGCCTACATGGCGTTTATCTCGAGATAAACGCCATGTAGGCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178785.3-3244s21c1
Sequence:CCGGTCAATGGGCACTTGAGCATTTCTCGAGAAATGCTCAAGTGCCCATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178785.3-1686s21c1
Sequence:CCGGAGGCCGTGAAGCACTGCTATTCTCGAGAATAGCAGTGCTTCACGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178785.3-3385s21c1
Sequence:CCGGCTGTGAGGTTGCCCAGTAAATCTCGAGATTTACTGGGCAACCTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178785
RASAL3 MISSION shRNA shRNA Plasmid DNA
RAS protein activator like 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178785.2-1590s1c1
Sequence:CCGGGCCATTGATGAATACATGAAACTCGAGTTTCATGTATTCATCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178785.2-1551s1c1
Sequence:CCGGGAAGCACTGCTATTCCGAGAACTCGAGTTCTCGGAATAGCAGTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178785.2-351s1c1
Sequence:CCGGCCACTGGAACCCAAGCCAAATCTCGAGATTTGGCTTGGGTTCCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178785.2-462s1c1
Sequence:CCGGGTTTGGAACATTGATGGCTTTCTCGAGAAAGCCATCAATGTTCCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178785.2-474s1c1
Sequence:CCGGGATGGCTTTACCCTTCTCGAACTCGAGTTCGAGAAGGGTAAAGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178785.3-2892s21c1
Sequence:CCGGACAATGTGAGGTGGCTATATTCTCGAGAATATAGCCACCTCACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178785.3-2181s21c1
Sequence:CCGGGGAAGCCTACATGGCGTTTATCTCGAGATAAACGCCATGTAGGCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178785.3-3244s21c1
Sequence:CCGGTCAATGGGCACTTGAGCATTTCTCGAGAAATGCTCAAGTGCCCATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178785.3-1686s21c1
Sequence:CCGGAGGCCGTGAAGCACTGCTATTCTCGAGAATAGCAGTGCTTCACGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178785.3-3385s21c1
Sequence:CCGGCTGTGAGGTTGCCCAGTAAATCTCGAGATTTACTGGGCAACCTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178785
RASAL3 MISSION shRNA Lentiviral Transduction Particles
RAS protein activator like 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178785.2-1590s1c1
Sequence:CCGGGCCATTGATGAATACATGAAACTCGAGTTTCATGTATTCATCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178785.2-1551s1c1
Sequence:CCGGGAAGCACTGCTATTCCGAGAACTCGAGTTCTCGGAATAGCAGTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178785.2-351s1c1
Sequence:CCGGCCACTGGAACCCAAGCCAAATCTCGAGATTTGGCTTGGGTTCCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178785.2-462s1c1
Sequence:CCGGGTTTGGAACATTGATGGCTTTCTCGAGAAAGCCATCAATGTTCCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178785.2-474s1c1
Sequence:CCGGGATGGCTTTACCCTTCTCGAACTCGAGTTCGAGAAGGGTAAAGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178785.3-2892s21c1
Sequence:CCGGACAATGTGAGGTGGCTATATTCTCGAGAATATAGCCACCTCACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178785.3-2181s21c1
Sequence:CCGGGGAAGCCTACATGGCGTTTATCTCGAGATAAACGCCATGTAGGCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178785.3-3244s21c1
Sequence:CCGGTCAATGGGCACTTGAGCATTTCTCGAGAAATGCTCAAGTGCCCATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178785.3-1686s21c1
Sequence:CCGGAGGCCGTGAAGCACTGCTATTCTCGAGAATAGCAGTGCTTCACGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178785.3-3385s21c1
Sequence:CCGGCTGTGAGGTTGCCCAGTAAATCTCGAGATTTACTGGGCAACCTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022904
RASAL3 MISSION shRNA Bacterial Glycerol Stock
RAS protein activator like 3
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000417331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022904.1-1625s21c1
Sequence:CCGGGAAGCTCGTGGCACAGGATTACTCGAGTAATCCTGTGCCACGAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022904.1-1842s21c1
Sequence:CCGGAGCTGGCGAGAAGCATGTAAACTCGAGTTTACATGCTTCTCGCCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022904.1-282s21c1
Sequence:CCGGATATTCCGTCGGGTCCTATCTCTCGAGAGATAGGACCCGACGGAATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022904
RASAL3 MISSION shRNA shRNA Plasmid DNA
RAS protein activator like 3
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000417331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022904.1-1625s21c1
Sequence:CCGGGAAGCTCGTGGCACAGGATTACTCGAGTAATCCTGTGCCACGAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022904.1-1842s21c1
Sequence:CCGGAGCTGGCGAGAAGCATGTAAACTCGAGTTTACATGCTTCTCGCCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022904.1-282s21c1
Sequence:CCGGATATTCCGTCGGGTCCTATCTCTCGAGAGATAGGACCCGACGGAATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022904
RASAL3 MISSION shRNA Lentiviral Transduction Particles
RAS protein activator like 3
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000417331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022904.1-1625s21c1
Sequence:CCGGGAAGCTCGTGGCACAGGATTACTCGAGTAATCCTGTGCCACGAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022904.1-1842s21c1
Sequence:CCGGAGCTGGCGAGAAGCATGTAAACTCGAGTTTACATGCTTCTCGCCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022904.1-282s21c1
Sequence:CCGGATATTCCGTCGGGTCCTATCTCTCGAGAGATAGGACCCGACGGAATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)