EMAIL THIS PAGE TO A FRIEND

RASEF

RAS and EF-hand domain containing

72 Gene Product Result for
Synonyms: RAB45
UniProtKB ID: Q8IZ41, A6NC29, Q96N04
Gene ID:
Human(158158) Summary: This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]
Mouse(242505) RAS and EF hand domain containing
Rat(298138) RAS and EF hand domain containing
domestic guinea pig(100717942) RAS and EF-hand domain containing
naked mole-rat(101724393) RAS and EF-hand domain containing
cow(513223) RAS and EF-hand domain containing
sheep(101119694) RAS and EF-hand domain containing
Zebrafish(570731) RAS and EF-hand domain containing
dog(484152) RAS and EF-hand domain containing
Horse(100055690) RAS and EF-hand domain containing
domestic cat(101081260) RAS and EF-hand domain containing
chicken(427451) RAS and EF-hand domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152573 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001017427 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001017427 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001017427 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU149121 MISSION® esiRNA esiRNA targeting mouse Rasef mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152573 Rosetta Predictions human pricing
XR_006670 Rosetta Predictions rat pricing
NM_001017427 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044276 predicted 849
2 SASI_Hs02_00366389 predicted 1712
3 SASI_Hs01_00044277 predicted 1309
4 SASI_Hs01_00044278 predicted 2278
5 SASI_Hs01_00044279 predicted 2457
6 SASI_Hs02_00366390 predicted 1599
7 SASI_Hs01_00044281 predicted 1324
8 SASI_Hs01_00044282 predicted 1009
9 SASI_Hs01_00044284 predicted 1551
10 SASI_Hs02_00366391 predicted 1939
11 SASI_Hs01_00044280 predicted 2422
12 SASI_Hs01_00044283 predicted 1271
13 SASI_Hs01_00044285 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00182797 predicted 2415
2 SASI_Rn02_00412571 predicted 2880
3 SASI_Rn01_00182800 predicted 2740
4 SASI_Rn01_00182801 predicted 1875
5 SASI_Rn02_00412572 predicted 2933
6 SASI_Rn01_00182803 predicted 1871
7 SASI_Rn02_00412573 predicted 2803
8 SASI_Rn01_00182804 predicted 2951
9 SASI_Rn02_00412574 predicted 2378
10 SASI_Rn02_00412575 predicted 2526
11 SASI_Rn01_00182798 predicted 2569
12 SASI_Rn01_00182799 predicted 2514
13 SASI_Rn01_00182802 predicted 2242
14 SASI_Rn01_00182805 predicted 2277
15 SASI_Rn01_00182806 predicted 1990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193900 predicted 1871
2 SASI_Mm01_00193901 predicted 871
3 SASI_Mm02_00287505 predicted 698
4 SASI_Mm01_00193902 predicted 1066
5 SASI_Mm01_00193903 predicted 992
6 SASI_Mm01_00193904 predicted 1324
7 SASI_Mm01_00193905 predicted 1805
8 SASI_Mm01_00193907 predicted 1833
9 SASI_Mm01_00193908 predicted 384
10 SASI_Mm01_00193909 predicted 1455
11 SASI_Mm01_00193906 predicted 1679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152573
RASEF MISSION shRNA Bacterial Glycerol Stock
RAS and EF-hand domain containing
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152573.2-1153s1c1
Sequence:CCGGGCCTTTCTTCAGAGTGAGTTACTCGAGTAACTCACTCTGAAGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152573.2-2144s1c1
Sequence:CCGGGCTTTCTTAACATACGAGAATCTCGAGATTCTCGTATGTTAAGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152573.2-738s1c1
Sequence:CCGGGCCAAGATTAATTCAGCCATACTCGAGTATGGCTGAATTAATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152573.2-907s1c1
Sequence:CCGGGCAGAACATAAGACACGGAAACTCGAGTTTCCGTGTCTTATGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152573.2-2189s1c1
Sequence:CCGGCCCATGAGACTGTTCCCATTACTCGAGTAATGGGAACAGTCTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152573.2-994s21c1
Sequence:CCGGGATCTGCAGGTGACCATTAAACTCGAGTTTAATGGTCACCTGCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152573.2-1354s21c1
Sequence:CCGGAGCAAGTTCAACAGATCTTTGCTCGAGCAAAGATCTGTTGAACTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152573.2-2412s21c1
Sequence:CCGGCAGATCCATTACCAATCTAACCTCGAGGTTAGATTGGTAATGGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152573
RASEF MISSION shRNA shRNA Plasmid DNA
RAS and EF-hand domain containing
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152573.2-1153s1c1
Sequence:CCGGGCCTTTCTTCAGAGTGAGTTACTCGAGTAACTCACTCTGAAGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152573.2-2144s1c1
Sequence:CCGGGCTTTCTTAACATACGAGAATCTCGAGATTCTCGTATGTTAAGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152573.2-738s1c1
Sequence:CCGGGCCAAGATTAATTCAGCCATACTCGAGTATGGCTGAATTAATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152573.2-907s1c1
Sequence:CCGGGCAGAACATAAGACACGGAAACTCGAGTTTCCGTGTCTTATGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152573.2-2189s1c1
Sequence:CCGGCCCATGAGACTGTTCCCATTACTCGAGTAATGGGAACAGTCTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152573.2-994s21c1
Sequence:CCGGGATCTGCAGGTGACCATTAAACTCGAGTTTAATGGTCACCTGCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152573.2-1354s21c1
Sequence:CCGGAGCAAGTTCAACAGATCTTTGCTCGAGCAAAGATCTGTTGAACTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152573.2-2412s21c1
Sequence:CCGGCAGATCCATTACCAATCTAACCTCGAGGTTAGATTGGTAATGGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152573
RASEF MISSION shRNA Lentiviral Transduction Particles
RAS and EF-hand domain containing
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152573.2-1153s1c1
Sequence:CCGGGCCTTTCTTCAGAGTGAGTTACTCGAGTAACTCACTCTGAAGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152573.2-2144s1c1
Sequence:CCGGGCTTTCTTAACATACGAGAATCTCGAGATTCTCGTATGTTAAGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152573.2-738s1c1
Sequence:CCGGGCCAAGATTAATTCAGCCATACTCGAGTATGGCTGAATTAATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152573.2-907s1c1
Sequence:CCGGGCAGAACATAAGACACGGAAACTCGAGTTTCCGTGTCTTATGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152573.2-2189s1c1
Sequence:CCGGCCCATGAGACTGTTCCCATTACTCGAGTAATGGGAACAGTCTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152573.2-994s21c1
Sequence:CCGGGATCTGCAGGTGACCATTAAACTCGAGTTTAATGGTCACCTGCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152573.2-1354s21c1
Sequence:CCGGAGCAAGTTCAACAGATCTTTGCTCGAGCAAAGATCTGTTGAACTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152573.2-2412s21c1
Sequence:CCGGCAGATCCATTACCAATCTAACCTCGAGGTTAGATTGGTAATGGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017427
RASEF MISSION shRNA Bacterial Glycerol Stock
RAS and EF-hand domain containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017427.1-3121s1c1
Sequence:CCGGGCACCTAACTTCAAGCATTAACTCGAGTTAATGCTTGAAGTTAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017427.1-298s1c1
Sequence:CCGGCGAGGCTTGAAGAAAGAACAACTCGAGTTGTTCTTTCTTCAAGCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017427.1-975s1c1
Sequence:CCGGGCTCAACAGATCCTTGCGTATCTCGAGATACGCAAGGATCTGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017427.1-1800s1c1
Sequence:CCGGCCACAGAACTATTCCTATCATCTCGAGATGATAGGAATAGTTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017427.1-1583s1c1
Sequence:CCGGGCGCAACTCTAGGAGTTGATTCTCGAGAATCAACTCCTAGAGTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017427
RASEF MISSION shRNA shRNA Plasmid DNA
RAS and EF-hand domain containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017427.1-3121s1c1
Sequence:CCGGGCACCTAACTTCAAGCATTAACTCGAGTTAATGCTTGAAGTTAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017427.1-298s1c1
Sequence:CCGGCGAGGCTTGAAGAAAGAACAACTCGAGTTGTTCTTTCTTCAAGCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017427.1-975s1c1
Sequence:CCGGGCTCAACAGATCCTTGCGTATCTCGAGATACGCAAGGATCTGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017427.1-1800s1c1
Sequence:CCGGCCACAGAACTATTCCTATCATCTCGAGATGATAGGAATAGTTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017427.1-1583s1c1
Sequence:CCGGGCGCAACTCTAGGAGTTGATTCTCGAGAATCAACTCCTAGAGTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017427
RASEF MISSION shRNA Lentiviral Transduction Particles
RAS and EF-hand domain containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017427.1-3121s1c1
Sequence:CCGGGCACCTAACTTCAAGCATTAACTCGAGTTAATGCTTGAAGTTAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017427.1-298s1c1
Sequence:CCGGCGAGGCTTGAAGAAAGAACAACTCGAGTTGTTCTTTCTTCAAGCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017427.1-975s1c1
Sequence:CCGGGCTCAACAGATCCTTGCGTATCTCGAGATACGCAAGGATCTGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017427.1-1800s1c1
Sequence:CCGGCCACAGAACTATTCCTATCATCTCGAGATGATAGGAATAGTTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017427.1-1583s1c1
Sequence:CCGGGCGCAACTCTAGGAGTTGATTCTCGAGAATCAACTCCTAGAGTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)