EMAIL THIS PAGE TO A FRIEND

RASGEF1A

RasGEF domain family, member 1A

172 Gene Product Result for
Synonyms: CG4853
UniProtKB ID: Q8N9B8, Q8TBF1
Gene ID:
Mouse(70727) RasGEF domain family, member 1A
Rat(312664) RasGEF domain family, member 1A
chicken(423631) RasGEF domain family, member 1A
dog(477759) RasGEF domain family, member 1A
Horse(100050134) RasGEF domain family, member 1A
domestic cat(101100596) RasGEF domain family, member 1A
cow(514877) RasGEF domain family, member 1A
sheep(101120047) RasGEF domain family, member 1A
naked mole-rat(101719863) RasGEF domain family, member 1A
domestic guinea pig(100733672) RasGEF domain family, member 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145313 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145313 Rosetta Predictions human pricing
XM_001077186 Rosetta Predictions rat pricing
XM_232315 Rosetta Predictions rat pricing
XM_001479962 Rosetta Predictions mouse pricing
XM_986257 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156821 predicted 1238
2 SASI_Hs01_00156822 predicted 1288
3 SASI_Hs01_00156823 predicted 268
4 SASI_Hs01_00156824 predicted 1924
5 SASI_Hs01_00156825 predicted 956
6 SASI_Hs01_00156826 predicted 873
7 SASI_Hs02_00365216 predicted 954
8 SASI_Hs01_00156828 predicted 1216
9 SASI_Hs01_00156829 predicted 408
10 SASI_Hs01_00156830 predicted 789
11 SASI_Hs01_00156827 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356106 predicted 450
2 SASI_Rn02_00356107 predicted 583
3 SASI_Rn02_00356108 predicted 401
4 SASI_Rn02_00356109 predicted 310
5 SASI_Rn02_00356110 predicted 493
6 SASI_Rn02_00356111 predicted 309
7 SASI_Rn02_00356112 predicted 290
8 SASI_Rn02_00356113 predicted 590
9 SASI_Rn02_00356114 predicted 561
10 SASI_Rn02_00356115 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232315 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387051 predicted 589
2 SASI_Rn02_00387052 predicted 722
3 SASI_Rn02_00387053 predicted 443
4 SASI_Rn02_00387054 predicted 1410
5 SASI_Rn02_00387055 predicted 631
6 SASI_Rn02_00387056 predicted 434
7 SASI_Rn02_00387057 predicted 820
8 SASI_Rn02_00387058 predicted 1150
9 SASI_Rn02_00387059 predicted 1027
10 SASI_Rn02_00387060 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00413992 predicted 1322
2 SASI_Mm02_00413993 predicted 608
3 SASI_Mm02_00413994 predicted 1557
4 SASI_Mm02_00413995 predicted 1348
5 SASI_Mm02_00413996 predicted 985
6 SASI_Mm02_00413997 predicted 1780
7 SASI_Mm02_00413998 predicted 795
8 SASI_Mm02_00413999 predicted 741
9 SASI_Mm02_00414000 predicted 1742
10 SASI_Mm02_00414001 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00449040 predicted 1351
2 SASI_Mm01_00265533 predicted 1553
3 SASI_Mm01_00265534 predicted 1347
4 SASI_Mm02_00449041 predicted 1191
5 SASI_Mm02_00449042 predicted 1417
6 SASI_Mm02_00449043 predicted 1250
7 SASI_Mm02_00449044 predicted 1456
8 SASI_Mm01_00265536 predicted 1775
9 SASI_Mm02_00449045 predicted 1611
10 SASI_Mm02_00449046 predicted 1734
11 SASI_Mm01_00265531 predicted 1323
12 SASI_Mm01_00265532 predicted 623
13 SASI_Mm01_00265535 predicted 986
14 SASI_Mm01_00265537 predicted 800
15 SASI_Mm01_00265538 predicted 747
16 SASI_Mm01_00265539 predicted 1751
17 SASI_Mm01_00265540 predicted 1182
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145313
RASGEF1A MISSION shRNA Bacterial Glycerol Stock
RasGEF domain family, member 1A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145313.2-274s21c1
Sequence:CCGGCCCGATAGGACGTACATCTTCCTCGAGGAAGATGTACGTCCTATCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145313.2-1559s21c1
Sequence:CCGGACGTGCACTAACTGGGTTTAACTCGAGTTAAACCCAGTTAGTGCACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145313.2-762s21c1
Sequence:CCGGGGACAGGGTCAGCAGCATTTACTCGAGTAAATGCTGCTGACCCTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145313.2-1774s21c1
Sequence:CCGGGTATCCATGATAACATCTTATCTCGAGATAAGATGTTATCATGGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145313.1-1287s1c1
Sequence:CCGGCGGGCACATTAACTTTAAGAACTCGAGTTCTTAAAGTTAATGTGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145313.1-955s1c1
Sequence:CCGGCGCATGTTGGAGTTCTTCATTCTCGAGAATGAAGAACTCCAACATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145313.1-408s1c1
Sequence:CCGGGCTGAAGTCTTTCTCAGCCAACTCGAGTTGGCTGAGAAAGACTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145313.1-1219s1c1
Sequence:CCGGCCTGTGTTCAACCTCTTCGTTCTCGAGAACGAAGAGGTTGAACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145313.1-1230s1c1
Sequence:CCGGCCTCTTCGTTAAGGACATCTACTCGAGTAGATGTCCTTAACGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145313
RASGEF1A MISSION shRNA shRNA Plasmid DNA
RasGEF domain family, member 1A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145313.2-274s21c1
Sequence:CCGGCCCGATAGGACGTACATCTTCCTCGAGGAAGATGTACGTCCTATCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145313.2-1559s21c1
Sequence:CCGGACGTGCACTAACTGGGTTTAACTCGAGTTAAACCCAGTTAGTGCACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145313.2-762s21c1
Sequence:CCGGGGACAGGGTCAGCAGCATTTACTCGAGTAAATGCTGCTGACCCTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145313.2-1774s21c1
Sequence:CCGGGTATCCATGATAACATCTTATCTCGAGATAAGATGTTATCATGGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145313.1-1287s1c1
Sequence:CCGGCGGGCACATTAACTTTAAGAACTCGAGTTCTTAAAGTTAATGTGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145313.1-955s1c1
Sequence:CCGGCGCATGTTGGAGTTCTTCATTCTCGAGAATGAAGAACTCCAACATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145313.1-408s1c1
Sequence:CCGGGCTGAAGTCTTTCTCAGCCAACTCGAGTTGGCTGAGAAAGACTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145313.1-1219s1c1
Sequence:CCGGCCTGTGTTCAACCTCTTCGTTCTCGAGAACGAAGAGGTTGAACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145313.1-1230s1c1
Sequence:CCGGCCTCTTCGTTAAGGACATCTACTCGAGTAGATGTCCTTAACGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145313
RASGEF1A MISSION shRNA Lentiviral Transduction Particles
RasGEF domain family, member 1A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145313.2-274s21c1
Sequence:CCGGCCCGATAGGACGTACATCTTCCTCGAGGAAGATGTACGTCCTATCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145313.2-1559s21c1
Sequence:CCGGACGTGCACTAACTGGGTTTAACTCGAGTTAAACCCAGTTAGTGCACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145313.2-762s21c1
Sequence:CCGGGGACAGGGTCAGCAGCATTTACTCGAGTAAATGCTGCTGACCCTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145313.2-1774s21c1
Sequence:CCGGGTATCCATGATAACATCTTATCTCGAGATAAGATGTTATCATGGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145313.1-1287s1c1
Sequence:CCGGCGGGCACATTAACTTTAAGAACTCGAGTTCTTAAAGTTAATGTGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145313.1-955s1c1
Sequence:CCGGCGCATGTTGGAGTTCTTCATTCTCGAGAATGAAGAACTCCAACATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145313.1-408s1c1
Sequence:CCGGGCTGAAGTCTTTCTCAGCCAACTCGAGTTGGCTGAGAAAGACTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145313.1-1219s1c1
Sequence:CCGGCCTGTGTTCAACCTCTTCGTTCTCGAGAACGAAGAGGTTGAACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145313.1-1230s1c1
Sequence:CCGGCCTCTTCGTTAAGGACATCTACTCGAGTAGATGTCCTTAACGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027526
RASGEF1A MISSION shRNA Bacterial Glycerol Stock
RasGEF domain family, member 1A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027526.1-1789s21c1
Sequence:CCGGGTAACCATGGTAACATCTTATCTCGAGATAAGATGTTACCATGGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027526.1-256s21c1
Sequence:CCGGGTTCCAACGGTGGACTATTATCTCGAGATAATAGTCCACCGTTGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027526.1-1003s21c1
Sequence:CCGGATCGGGAACTTCAACTCTATGCTCGAGCATAGAGTTGAAGTTCCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027526.1-1281s21c1
Sequence:CCGGCCTACCCAATGGGCACATTAACTCGAGTTAATGTGCCCATTGGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027526.1-567s21c1
Sequence:CCGGCATTGCCCAAATGATACAAAGCTCGAGCTTTGTATCATTTGGGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027526
RASGEF1A MISSION shRNA shRNA Plasmid DNA
RasGEF domain family, member 1A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027526.1-1789s21c1
Sequence:CCGGGTAACCATGGTAACATCTTATCTCGAGATAAGATGTTACCATGGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027526.1-256s21c1
Sequence:CCGGGTTCCAACGGTGGACTATTATCTCGAGATAATAGTCCACCGTTGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027526.1-1003s21c1
Sequence:CCGGATCGGGAACTTCAACTCTATGCTCGAGCATAGAGTTGAAGTTCCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027526.1-1281s21c1
Sequence:CCGGCCTACCCAATGGGCACATTAACTCGAGTTAATGTGCCCATTGGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027526.1-567s21c1
Sequence:CCGGCATTGCCCAAATGATACAAAGCTCGAGCTTTGTATCATTTGGGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027526
RASGEF1A MISSION shRNA Lentiviral Transduction Particles
RasGEF domain family, member 1A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027526.1-1789s21c1
Sequence:CCGGGTAACCATGGTAACATCTTATCTCGAGATAAGATGTTACCATGGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027526.1-256s21c1
Sequence:CCGGGTTCCAACGGTGGACTATTATCTCGAGATAATAGTCCACCGTTGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027526.1-1003s21c1
Sequence:CCGGATCGGGAACTTCAACTCTATGCTCGAGCATAGAGTTGAAGTTCCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027526.1-1281s21c1
Sequence:CCGGCCTACCCAATGGGCACATTAACTCGAGTTAATGTGCCCATTGGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027526.1-567s21c1
Sequence:CCGGCATTGCCCAAATGATACAAAGCTCGAGCTTTGTATCATTTGGGCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)