EMAIL THIS PAGE TO A FRIEND

RASGEF1B

RasGEF domain family, member 1B

132 Gene Product Result for
Synonyms: GPIG4
UniProtKB ID: Q0VAM2, Q0VAM1, Q4W5L7, Q4W5M3, Q96MY8
Gene ID:
Mouse(320292) RasGEF domain family, member 1B
Rat(100361238) RasGEF domain family, member 1B
domestic guinea pig(100725609) RasGEF domain family, member 1B
naked mole-rat(101726753) RasGEF domain family, member 1B
Domestic Rabbit(100347335) RasGEF domain family, member 1B
cow(506971) RasGEF domain family, member 1B
sheep(101114193) RasGEF domain family, member 1B
chicken(100859744) RasGEF domain family, member 1B
domestic cat(101089437) RasGEF domain family, member 1B
Horse(100146797) RasGEF domain family, member 1B
dog(607404) RasGEF domain family, member 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152545 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152545 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152545 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152545 Rosetta Predictions human pricing
NM_145839 Rosetta Predictions mouse pricing
NM_181318 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366349 predicted 290
2 SASI_Hs01_00236876 predicted 351
3 SASI_Hs01_00236879 predicted 386
4 SASI_Hs02_00366350 predicted 430
5 SASI_Hs01_00236880 predicted 602
6 SASI_Hs01_00236881 predicted 366
7 SASI_Hs01_00236882 predicted 303
8 SASI_Hs01_00236883 predicted 335
9 SASI_Hs01_00236884 predicted 513
10 SASI_Hs01_00236885 predicted 555
11 SASI_Hs01_00236877 predicted 502
12 SASI_Hs01_00236878 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059563 predicted 944
2 SASI_Mm01_00059564 predicted 1014
3 SASI_Mm01_00059565 predicted 410
4 SASI_Mm01_00059566 predicted 1379
5 SASI_Mm01_00059567 predicted 1341
6 SASI_Mm01_00059568 predicted 969
7 SASI_Mm01_00059570 predicted 1066
8 SASI_Mm01_00059571 predicted 362
9 SASI_Mm01_00059572 predicted 1326
10 SASI_Mm02_00341321 predicted 925
11 SASI_Mm01_00059569 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112736 predicted 947
2 SASI_Mm01_00112737 predicted 1004
3 SASI_Mm01_00112738 predicted 415
4 SASI_Mm01_00112739 predicted 1379
5 SASI_Mm01_00112740 predicted 1340
6 SASI_Mm01_00112741 predicted 968
7 SASI_Mm01_00112743 predicted 1065
8 SASI_Mm01_00112744 predicted 357
9 SASI_Mm01_00112745 predicted 1327
10 SASI_Mm02_00349671 predicted 925
11 SASI_Mm01_00112742 predicted 1016
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145839
VALIDATED
RASGEF1B MISSION shRNA Bacterial Glycerol Stock
RasGEF domain family, member 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145839.1-916s1c1
Sequence:CCGGGCGTACGTAGAATGGTTTAATCTCGAGATTAAACCATTCTACGTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145839.1-1904s1c1
Sequence:CCGGGCCTGAACATTTGCTGCTAATCTCGAGATTAGCAGCAAATGTTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145839.1-344s1c1
Sequence:CCGGTCCTGCTTAGTTCTCGGTTATCTCGAGATAACCGAGAACTAAGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145839.1-345s1c1
Sequence:CCGGCCTGCTTAGTTCTCGGTTATTCTCGAGAATAACCGAGAACTAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145839.1-1363s1c1
Sequence:CCGGGCCAAACAAGTGAGTGAATTTCTCGAGAAATTCACTCACTTGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145839
VALIDATED
RASGEF1B MISSION shRNA shRNA Plasmid DNA
RasGEF domain family, member 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145839.1-916s1c1
Sequence:CCGGGCGTACGTAGAATGGTTTAATCTCGAGATTAAACCATTCTACGTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145839.1-1904s1c1
Sequence:CCGGGCCTGAACATTTGCTGCTAATCTCGAGATTAGCAGCAAATGTTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145839.1-344s1c1
Sequence:CCGGTCCTGCTTAGTTCTCGGTTATCTCGAGATAACCGAGAACTAAGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145839.1-345s1c1
Sequence:CCGGCCTGCTTAGTTCTCGGTTATTCTCGAGAATAACCGAGAACTAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145839.1-1363s1c1
Sequence:CCGGGCCAAACAAGTGAGTGAATTTCTCGAGAAATTCACTCACTTGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145839
VALIDATED
RASGEF1B MISSION shRNA Lentiviral Transduction Particles
RasGEF domain family, member 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145839.1-916s1c1
Sequence:CCGGGCGTACGTAGAATGGTTTAATCTCGAGATTAAACCATTCTACGTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145839.1-1904s1c1
Sequence:CCGGGCCTGAACATTTGCTGCTAATCTCGAGATTAGCAGCAAATGTTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145839.1-344s1c1
Sequence:CCGGTCCTGCTTAGTTCTCGGTTATCTCGAGATAACCGAGAACTAAGCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145839.1-345s1c1
Sequence:CCGGCCTGCTTAGTTCTCGGTTATTCTCGAGAATAACCGAGAACTAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145839.1-1363s1c1
Sequence:CCGGGCCAAACAAGTGAGTGAATTTCTCGAGAAATTCACTCACTTGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152545
RASGEF1B MISSION shRNA Bacterial Glycerol Stock
RasGEF domain family, member 1B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152545.1-1746s1c1
Sequence:CCGGGCTGACAGATAGACTCAGATTCTCGAGAATCTGAGTCTATCTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152545.1-355s1c1
Sequence:CCGGCGGTTATTTATGCATCCGTATCTCGAGATACGGATGCATAAATAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152545.1-1468s1c1
Sequence:CCGGGCTCTCTACTTGGCTTCTTATCTCGAGATAAGAAGCCAAGTAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152545.1-274s1c1
Sequence:CCGGGAAGCACTCATCCAGCACTTACTCGAGTAAGTGCTGGATGAGTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152545.1-497s1c1
Sequence:CCGGCGGAAACATTTCCCTATGATTCTCGAGAATCATAGGGAAATGTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152545
RASGEF1B MISSION shRNA shRNA Plasmid DNA
RasGEF domain family, member 1B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152545.1-1746s1c1
Sequence:CCGGGCTGACAGATAGACTCAGATTCTCGAGAATCTGAGTCTATCTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152545.1-355s1c1
Sequence:CCGGCGGTTATTTATGCATCCGTATCTCGAGATACGGATGCATAAATAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152545.1-1468s1c1
Sequence:CCGGGCTCTCTACTTGGCTTCTTATCTCGAGATAAGAAGCCAAGTAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152545.1-274s1c1
Sequence:CCGGGAAGCACTCATCCAGCACTTACTCGAGTAAGTGCTGGATGAGTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152545.1-497s1c1
Sequence:CCGGCGGAAACATTTCCCTATGATTCTCGAGAATCATAGGGAAATGTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152545
RASGEF1B MISSION shRNA Lentiviral Transduction Particles
RasGEF domain family, member 1B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152545.1-1746s1c1
Sequence:CCGGGCTGACAGATAGACTCAGATTCTCGAGAATCTGAGTCTATCTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152545.1-355s1c1
Sequence:CCGGCGGTTATTTATGCATCCGTATCTCGAGATACGGATGCATAAATAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152545.1-1468s1c1
Sequence:CCGGGCTCTCTACTTGGCTTCTTATCTCGAGATAAGAAGCCAAGTAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152545.1-274s1c1
Sequence:CCGGGAAGCACTCATCCAGCACTTACTCGAGTAAGTGCTGGATGAGTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152545.1-497s1c1
Sequence:CCGGCGGAAACATTTCCCTATGATTCTCGAGAATCATAGGGAAATGTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)